Why are the first 20 bases typically ignored from a Sanger sequencing ab1 file? O The data quality is too low and the data is noisy The peaks are different heights Only N's are sequenced The data represents the primer

Why are the first 20 bases typically ignored from a Sanger sequencing ab1 file? O The data quality is too low and the data is noisy The peaks are different heights Only N's are sequenced The data represents the primer

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter15: Biotechnology

Section: Chapter Questions

Problem 2CT: The results of a paternity test are shown in the table below. Numbers indicate the number of short...

See similar textbooks

Related questions

Q: Which of the following steps is NOT used in whole genome sequencing? Select one alternative: O…

A: WGS stands for whole-genome sequencing and is a method for examining complete genomes. Identifying…

Q: 1. An image of a DNA profile is shown below. The size marker fragments are not shown, but the size…

A: STR stands for Short Tandem Repeat . This analysis is a common molecular biology method. It is used…

Q: The basis for the 1-pot DNA sequencing method (discussed in the lecture) is use of ddNTPs…

A: A fluorophore is a fluorescent compound that has the property of re-emitting light when light falls…

Q: Calculate the DN/DS ratio for the sequences below. TTT ACT AAT AGT TTC CCT AAC GAT

A: A codon is a combination of three nucleotides that codes for an amino acid. A single codon codes…

Q: DNA SEQUENCE IN FUNCTIONAL (UNAFFECTED) CFTR ALLELE DNA Gene Base ancestral Sequence:…

A: Since you have multiple questions, we're answering the first one for you. If you want any other…

Q: An alteration in the DNA from an CG base pair to a AT base pair is called a Select one: O a.…

Q: A research team interested in mapping human genes discovered a new restriction length polymorphism…

A: Restriction fragment length polymorphisms (RFLPs) uses the variations in DNA sequences of genome…

Q: How many fragments are produced if ddT is added to the following DNA segment during Sanger…

A: DNA is arranged in a specific sequence of nucleotides. The sequence consists of four types of…

Q: You have a linear DNA of 800bp. You cloned a type I and a Type lls RE site separated by 200bp and…

A: DNA recombinant technology is one of the advanced technologies of genetic engineering and molecular…

Q: If the primer that you design anneals to two different regions of the DNA to be sequenced, the…

A: A primer is a short sequence of nucleic acids that serves as a starting point for DNA synthesis.…

Q: Why are the first 20 bases typically ignored from a Sanger sequencing .ab1 file? The data quality is…

A: The data quality is too low and the data is noisy

Q: You extract DNA from 200 milligram of wheat germ. Your total volume of DNA extraction sample is 500…

A: Given values: Total DNA extracted = 500 μL Total weight of wheat used for DNA extraction = 200 mg…

Q: you performed a sanger sequencing on a particular segment of DNA. Explain at the molecular level…

A: Effect on gel profile when we either forgot to add ddNTPs Or add more ddNTPs in test tubes during…

Q: DNA from 100 unrelated individuals from one population of Chinook salmon were amplified at a single…

A: A population is said to be in Hardy Weinberg equilibrium if it satisfies 2 equations; p+q+r=1 and…

Q: A F- recombinant is only made after conjugation of a ________ strain with a _______, while an ______…

A: The fertility factor also known as F plasmid refers to a sex factor that allows the transfer of…

Q: A gel pattern displaying PCR products shows four strong bands. The four pieces of DNA have lengths…

A: The polymerase chain reaction is a molecular biological technique responsible for exponentially…

Q: Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to…

A: Answer: REPLICATION of DNA : It is the process in molecular biology where DNA strands are used to…

Q: A woman claims that either David Spade or Andy Richter is the father of her child. DNA samples are…

A: Southern blot is a tool mainly use in molecular biology. This method is used for the detection of…

Q: The presence (+) or absence (−) of six sequences in each of five bacterial artificial chromosome…

A: Bacteria are a prokaryotic microbe which have undefined nucleus and nuclear membrane. Bacterial…

Q: R. Alu 100 100 300 F ----- 100 100 Where would you expect to see a band or bands if you used PCR to…

A: 500 bp template was prepared by using amplified PCR with forward and reverse primers of 100 bp each…

Q: What is not true for Sequence tagged site (STS) markers: cannot be mapped by fluorescence in situ…

Q: You wish to amplify gene Y alone from the double-stranded DNA shown in the figure below. Identify…

A: Primer binding sites for the amplification of gene "Y" only.

Q: The bisulfite sequencing is different from regular sanger sequencing of nucleotides because…

A: The Sanger sequencing is also known as the chain termination method, it is a method used to…

Q: What was the purpose of the random hexamer primers? O primer for GoTaq O amplify the MRNA O primer…

A: Primer These are the short nucleic acid sequences that are are helpful in providing an initiator…

Q: As a scientist in Company X, your manager asks you to design a methodology to separate the three DNA…

A: DNA sequencing is a process of determining the sequence of nucleotide bases in a piece of a DNA .…

Q: Explain the V(D)J recombination of multiple gene elements

A: RECOMBINATION It is the process in which pieces of DNA are broken physically, exchanged, and then…

Q: e. four-base, not overlapping4. An example of a portion of the T4 rIIB gene in whichCrick and…

A: The mutation is the alteration of the nucleotide sequence in an organism's genome. The mutation…

Q: Identify the incorrect statements O Each primer should have 40-60% GC content The annealing…

A: The success of PCR depends on various factors which involves- 1. Template DNA 2. Primers 3. dNTPs 4.…

Q: You have this sequence of DNA from leading strand: GGCATGCGA From this you know: * O G is the 5'end…

A: DNA acts as genetic material in all living organisms. During replication of DNA, at each replication…

Q: Are you a hidden heterozygote? A PCR analysis (part2) Agarose gel electrophoresis and interpretation…

A: Agarose gel concentration More the concentration of the agarose gel more smaller will be its pores.…

Q: After using the blender to blend the split peas, water, and salt mixture, cheesecloth is used to. .…

A: It is a cotton cloth that is loosely woven and resembles gauze.

Q: You have used the primer 5' CTGA 3' in a DNA sequencing reaction with the template DNA sequence…

A: Primers are short RNA sequences that are used in the DNA replication process to initiate DNA…

Q: Types of SNPS: Select one: a. • Non-coding region. O b. Causative SNPS. • All of above answer. O d.…

A: SNPs are single nucleotide polymorphism which show genetic variations among individual. These SNPs…

Q: An individual’s unique set of_______ can be used in DNA profiling. a. DNA sequences c. SNPs b. short…

A: Introduction In the genome, there is usually two types of nucleic acid sequence present. One is…

Q: Which of the following is/are not required for DNAreplication to occur?a. DNA polymerase d.…

A: DNA (short for deoxyribonucleic acid) is a double helical structure (with two DNA strands). A…

Q: You are studying a genome that has 42% G:C content and the remaining 58% of the genome is As and Ts.…

A: Restriction enzymes The enzyme that is use to cut the DNA at specific site.

Q: Which of the following is NOT a recombinant organism? Lütfen birini seçin: O a. Cow that produces…

A: Ans :Option (b) is right.

Q: (AKS 8a2, DOK 1) A gel from gel electrophoresis is shown below B. Which DNA Fragment is the…

A: Gel electrophoresis is an analytical technique which is used for the separation of DNA; RNA and…

Q: The sequences of the recombination sites recognized by site-specific recombinases area) Partially…

A: Recombination is a process by which pieces of deoxyribonucleic acid (DNA) are broken and recombined…

Q: Below are 9 possible primer pairs. • Determine which primer pair is the best choice. • Explain why…

A: Primers Primers are short nucleotide sequences (18-22bp long) used to synthesise a complementary…

Q: In regards to satellite DNA, the major difference between a LINE sequence and a SINE sequence is the…

A: In molecular biology, there are two types of genes ,coding and noncoding. Coding genes helps in the…

Q: Identify the false statements. There may be more than one correct answer. A) The binding of DNA to a…

A: Genomic DNA and plasmid DNA are isolated using silica resin columns than using traditional…

Q: Could I get a background on the repo gene (reversed polarity

A: repo gene is reversed polarity gene that is abundantly studied in Drosophila melanogaster.

Q: Below are 9 possible primer pairs. ● Determine which primer pair is the best choice. ● Explain why…

A: Primers are used in the PCR or polymerase chain reaction. These primers anneal at a particular…

Q: Chromosomal rearrangements can be caused crossing over between repetitive (duplicated) DNA segments…

A: Genetic variation ranges from a single nucleotide which is called single nucleotide polymorphism to…

Q: Some recombinant DNA techniques depend on the specific hybridization (or annealing) between two…

A: Recombinant DNA technology comprises altering genetic material outside an organism to obtain…

Q: TFIIF Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an…

A: TFIIF It is a eukaryotic transcription factor. It is involved in the formation of the…

Q: BamHI KpnI SpeI XhoI PatI HindIII 400 500 200 300 700 NotI 75 2580 ECORI Frog DNA BamHI 575 KpnI…

A: Introduction When A Genetically Changed Vector Is Introduced And Incorporated Into The Genome Of An…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

This question relates to DNA extraction the choices are in the attached photo

Why are the first 20 bases typically ignored from a Sanger sequencing .ab1 file.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Can you explain thie each of the statement given i dont really understand the dna recombinant is used as a molecular cloning and application for recombinant dna
Aside from Sanger Sequencing, what are the other DNA sequencing methods that are available today? Search for all of them and TABULATE your results. The TABLE should compare Sanger sequencing with the other sequencing methods.
In STR DNA typing, a typical DNA pattern shows (two, three) bands.
Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH
Sanger sequencing originally used 4 lanes in gels. These lanes represented sequences of different lengths obtained by adding:
Which of the following reagents is NOT correct reagents for the Sanger method of DNA sequencing? a. All four dNTPs b. a small amount of specific ddNTP c. DNA Polymerase d. DNA template to be sequenced e. Pair of primers
Analysis of two loci for investigation Someone broke into the bookstore and stole thousands of dollars’ worth of textbooks. Some hairs were left behind, from which DNA was extracted. An individual was caught with all five of the stolen textbooks in his bag. He claims his friend gave them to him. You decide to amplify two regions of the DNA (two loci, plural of locus) and digest the samples, and get the following result on the electrophoresis gel.L = Standard marker 1 = Suspect 1 2 = Suspect 2 3 = DNA from crime scene (Note: assume bands that are close in distance traveled are the same length. Higher concentrations of DNA can make a band appear to travel farther.) What does locus B tell you about the reliability of using loci for analysis?
A ssDNA solution is diluted by taking 3uL of a stock solution, which is made up to 60uL withwater. From this stock, 10uL is taken and diluted to 100uL with water. The solution is then madeup to 3mL. The A260 was 0.012. Calculate the concentration of DNA in the original stock inug/mL
you performed a sanger sequencing on a particular segment of DNA. Explain at the molecular level what your gel profile would look like due to this mistake. a. you forgot to add ddNTPs to your test tube. b. you added too much ddNTPs to your test tube
The gel pattern below was produced by the Sanger sequencing method. Determine the sequence (including 5' and 3' ends) of the double-stranded DNA fragment used to make this gel.
I have a 1.270 ug/uL dna stock, how would you dilute this to 50ng/nL in a single dilution step? show the exact process including the volume of water. Indicate if you would use p20,p200,p1000 for each reagant added. you can choose a total volume but cannot be less than 3 uL or exceed 1000uL. Thank you!!
Shown below are eight DNA sequences from different individuals QGive the nucleotide positions of all single-nucleotide polymorphisms (SNPs; nucleotide positions where individuals vary in which base is present) in these sequences. uals