Write a program in C to print a diamond using *. Ask the use to input the height of the pyramid. Using the height given by the user (data validity needed), use nested loops to draw the pyramid

C#(Sharp): I made my code and design below. Anybody can help me some correction and add some design button and code. "Need to make C# step by step design and code "Calculator where make a calculator program that can do add, subtract, multiply, divide and square root. It should have a memory save/restore function for one number. There should be a way to set the number of fraction digits displayed".     Code: using System; using System.Collections.Generic; using System.ComponentModel; using System.Data; using System.Drawing; using System.Linq; using System.Text; using System.Threading.Tasks; using System.Windows.Forms; namespace AktCalc { public partial class Form1 : Form { string last = ""; bool minus = false; bool plus = false; bool divide = false; bool multiply = false; string memory = ""; public Form1() { InitializeComponent(); } private void button2_Click(object sender, EventArgs e) { if (textBox1.Text.Contains(",")) { return; } else { textBox1.Text += ","; } } private void…

Please fill in the blanks. /* This function asks for 2 strings from the user and asks the user to choose what they want to do with them.   Inputs: 2 strings, and a character for choice. Output: execute that choice.   Choices can be: 'E'/'e': call checkEqual() function                  'C'/'c': call concatStrings() function                   Everything else: invalid and exit  */   #include<__1__> //library to use printf and scanf #include<__2__> //library to use boolean #include<__3__> //library to use exit(0) #define len 1000 /*This function just concatenates 2 strings using a */ __4__ concatStrings(__5__ w1[], __6__ w2[], __7__ w3[]) {             int w3_idx = 0; //index for w3               //Copy word1 w1 over to the combined string             for(int i = 0; __8__ != __9__; i++) //loop runs as long as string is not done             {                         __10__[__11__] = __12__[__13__]; //copy a character from w1 to w3                         w3_idx++; //update…

Looping Construct with Floating Point Numbers Write a program that utilizes a while-loop to read a set of five floating-point values from user input. Include code to prevent an endless loop. Ask the user to enter the values, then print the following data: Total Average Maximum Minimum Interest on total at 20% Answer:

I can both pass and return an array value from a function. Group of answer choices: True False   this is for c++

C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…

C Programming Write function checkHorizontal to count how many discs of the opposing player would be flipped, it should do the following a. Return type integer b. Parameter list i. int rowii. int col iii. char board[ROW][COL] iv. char playerCharc. If the square to the left or right is a space, stop checking d. If the square to the left or right is the same character as the player’s character, save that it was a flank, stop checking e. If the square to the left or right is not the same character as the player’s character, count the disc f. If the counted discs is greater than zero AND the player found their own character, return the counted discs, otherwise return ZERO Write function checkVertical to count how many discs of the opposing player would be flipped, it should do the following a. Return type integer b. Parameter list i. int rowii. int col iii. char board[ROW][COL] iv. char playerCharc. If the square above or below is a space, stop checking d. If the square above or below is…

Programming Language: C++ 4. Select the two correct statements about stub functions: Select one or more: a. stubs are used to test the functionality of a program b. stubs must return a value c. stubs are programs that test if a called function returns the correct result d. stubs are simpler than the functions they replace