Write and draw out the three-letter abbreviation of the amino acid sequence histidine,alanine,asparagine,alanine,histidine. Using the pka values calculate the isoelectric point of that amino acid sequence. include c and n terminus for amino acids with no pH. pka c term= 2, pka n term=9, pH of histidine is 6.04. then indicate which two pKa were used to calculate the pl.

Write and draw out the three-letter abbreviation of the amino acid sequence histidine,alanine,asparagine,alanine,histidine. Using the pka values calculate the isoelectric point of that amino acid sequence. include c and n terminus for amino acids with no pH. pka c term= 2, pka n term=9, pH of histidine is 6.04. then indicate which two pKa were used to calculate the pl.

Biochemistry

9th Edition

ISBN:9781305961135

Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Chapter3: Amino Acids And Peptides

Section: Chapter Questions

Problem 11RE: MATHEMATICAL Sketch a titration curve for the amino acid cysteine, and indicate the pKa values for...

See similar textbooks

Similar questions

REFECT AND APPLY Write equations to show the ionic dissociation reactions of the following amino acids: aspartic acid, valine, histidine, serine, and lysine.
REFECT AND APPLY Answer Question 30 using one-letter designations for the amino acids.
MATHEMATICAL Predict the predominant forms of the amino acids from Question 8 at pH 10.
MATHEMATICAL Sketch a titration curve for the amino acid lysine, and indicate the pKa values for all titratable groups. Also indicate the pH at which the amino acid has no net charge.
MATHEMATICAL Sketch a titration curve for the amino acid cysteine, and indicate the pKa values for all titratable groups. Also indicate the pH at which this amino acid has no net charge.
MATHEMATICAL Predict the predominant ionized forms of the following amino acids at pH 7: glutamic acid, leucine, threonine, histidine, and arginine.
REFECT AND APPLY What would be the pI for the mythical amino acid described in Question 18?
GTTTTCACTGGCGAGCGTCATCTTCCTACT 10. Generate a secondary structure prediction for one identified protein.
biochem question Write and draw out the three-letter abbreviation of the amino acid sequence histidine,alanine,asparagine,alanine,histidine. Using the pka values calculate the isoelectric point of that amino acid sequence. include c and n terminus for amino acids with no pH. pka c term= 2, pka n term=9, pH of histidine is 6.04. then indicate which two pKa were used to calculate the pl. thank you
GT 3 A. Write the structure of the pentapeptide GLDSC. B. What is the complete name of this pentapeptide? Show a tertiary structure of ACGGC after a disulfide bond forms. A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin; the other was treated with cyanogen bromide. Given the following sequences (N-terminal to C- terminal) of the resulting fragments, deduce the sequence of the original peptide. Trypsin treatment Asn-Thr-Trp-Met-lle-Lys Gly-Tyr-Met-Gln-Phe Val-Leu-Gly-Met-Ser-Arg Cyanogen bromide treatment Gln-Phe Val-Leu-Gly-Met lle-Lys-Gly-Tyr-Met Ser-Arg-Asn-Thr-Trp-Met
GT 3 A. Write the structure of the pentapeptide GLDSC. B. What is the complete name of this pentapeptide? 1. Show a tertiary structure of ACGGC after a disulfide bond forms. A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin; the other was treated with cyanogen bromide. Given the following sequences (N-terminal to C-terminal) of the resulting fragments, deduce the sequence of the original peptide. 2. 3. Trypsin treatment Asn-Thr-Trp-Met-lle-Lys Gly-Tyr-Met-GIn-Phe Val-Leu-Gly-Met-Ser-Arg Cyanogen bromide treatment Gln-Phe Val-Leu-Gly-Met lle-Lys-Gly-Tyr-Met Ser-Arg-Asn-Thr-Trp-Met
Why different amino acids have different Rf values? If you separate a mixture of amino acids consist of glutamic acid, histidine, glycine, tryptophan and isoleucine with paper chromatography using NH3: Benzene (10:90) as a mobile phase what do you expect the Rf values of the amino acids will be?