You are cloning the genome of a new DNA virus into pUC18. You plate out your transformants on ampicillin plates containing X-gal and pick one blue colony and one white colony. When you check the size of the inserts in each plasmid (blue and white), you are surprised to find that the plasmid from the blue colony contains a very small insert of approximately 60 bp, while the plasmid from the white colony does not appear to contain any insert at all. Explain these results.

You are cloning the genome of a new DNA virus into pUC18. You plate out your transformants on ampicillin plates containing X-gal and pick one blue colony and one white colony. When you check the size of the inserts in each plasmid (blue and white), you are surprised to find that the plasmid from the blue colony contains a very small insert of approximately 60 bp, while the plasmid from the white colony does not appear to contain any insert at all. Explain these results.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 12TYK: Discuss Concepts A forensic scientist obtained a small DNA sample from a crime scene. In order to...

See similar textbooks

Similar questions

You are cloning the genome of a new DNA virus into pUC18.You plate out your transformants on ampicillin plates containing X-gal and pick one blue colony and one white colony.When you check the size of the inserts in each plasmid (blueand white), you are surprised to fi nd that the plasmid fromthe blue colony contains a very small insert of approximately60 bp, while the plasmid from the white colony does notappear to contain any insert at all. Explain these results.
24. In recombinant DNA technology, genes are usually inserted into what form of DNA before being transferred into bacteria? - [ ] Teddy bear - [ ] Nucleus - [ ] Transposon - [ ] Ribosome - [ ] Plasmid 25. In PCR , what is happening at the denaturation step (94 )? - [ ] RNA polymerase creates a new RNA strand . - [ ] DNA strands come apart . - [ ] DNA polymerase creates a new DNA strand. - [ ] Primers bind to the target DNA. - [ ] Nucleotides bind to the primer .
Discuss Concepts A forensic scientist obtained a small DNA sample from a crime scene. In order to examine the sample, he increased its quantity by cycling the sample through the polymerase chain reaction. He estimated that there were 50,000 copies of the DNA in his original sample. Derive a simple formula and calculate the number of copies he will have after15 cycles of the PCR.
1. You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions.a. PscI & GsuIb. ScaI, PdmI & BsaXI c.ScaI, SspI & EheI
2. You are cloning the genome of a new DNA virus into pUC18. You plate out your transformants on ampicillin plates con-taining X-gal and pick one blue colony and one white colony. When you check the size of the inserts in each plasmid (blueand white), you are surprised to fi nd that the plasmid fromthe blue colony contains a very small insert of approximately60 bp, while the plasmid from the white colony does notappear to contain any insert at all. Explain these results.
1 (a) What do ApR, TcR, and ori on the pBR322 map represent and discuss there individual functions? (b)Does the undigested plasmid show more than a single band when electrophoresed? Why? (c)What other kinds of molecules, in addition to plasmid DNA would you expect to find in a sample of plasmid DNA extraction? (This is not a graded assignment)
5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answer
2. A plasmid was digested with the enzyme EcoRI. On agarose gel electrophoresis, you observe four bands, 200, 550, 1200, and 4600 bp. a. How many EcoRI sites are present in this plasmid? b. What are the distances between each site? c. What is the size of the plasmid?
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
1. a) If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? op 1: 3'-CAGTTAGTCA-5' op 2: 3'-TGACTAACTG-5' op 3: 5'-TGACTAACTG-3' op 4: 3'-TGACTAACTG-5' b) What is the nucleotide sequence of the DNA strand that is complementary to 5'-ATCGCAACTGTCACTA-3' op 1: 5'-TAGCGTTGACAGTGATA-3' op 2: 5'-TAGTGACAGTTGCGAT-3' op 3: 5'-ATCACTGTCAACGCTA-3' op 4: 5'-UAGUGACAGUUGCGAU-3'
1c) During DNA replication, both positive and negative supercoiling is introduced in the DNA being replicated. Name the enzymes that introduce supercoiling into DNA during replication; please clearly indicate which enzyme(s) introduce positive supercoiling and which enzyme(s) introduce negative supercoiling.
1. You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions. a. PscI & GsuI b. ScaI, PdmI & BsaXI c. ScaI, SspI & EheI 2. You have determined that the amplicon you want to clone has enzyme restriction sites for HindIII and EcoRI. After investigation you have seen that the pUC18/19 plasmid also have these enzyme restriction sites in its multiple cloning site (MCS on map above). After enzyme digestion your amplicon is 854 bp long. a. What length will the recombinant plasmid be after you have inserted your amplicon? Show your calculation. b. In the amplicon insert you have an enzyme restriction site for NdeI at 500 bp. If you digest the recombinant plasmid with this enzyme what length will the fragments be?