You are studying RNA viruses and have discovered a new one that grows well in a culture of eukaryotic cells. You know that the virus is a single-stranded RNA virus, but you don’t know if it is plus or minus stranded. Your lab-mate says, “Well, just treat your cell culture with cyclohexamide and see if the virus replicates its genome.” You know that cyclohexamide inhibits protein elongation by binding to eukaryotic ribosomes. What is the basis of your lab-mate’s suggestion?

You are studying RNA viruses and have discovered a new one that grows well in a culture of eukaryotic cells. You know that the virus is a single-stranded RNA virus, but you don’t know if it is plus or minus stranded. Your lab-mate says, “Well, just treat your cell culture with cyclohexamide and see if the virus replicates its genome.” You know that cyclohexamide inhibits protein elongation by binding to eukaryotic ribosomes. What is the basis of your lab-mate’s suggestion?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 23QP: How does DNA replication occur in a precise manner to ensure that identical genetic information is...

See similar textbooks

Similar questions

The smallpox virus, which actually has a fairly large genome size for a virus (about 190,000 base pairs), must use which of the following enzymes to replicate its nucleic acid? A. DNA-dependent-DNA-polymerase B. RNA-dependent-DNA-polymerase C. DNA-dependent-RNA-polymerase D. RNA-dependent-RNA-polymerase E. reverse transcriptase
Which of the following experimental results was NOT evidence that DNA is the genetic molecule rather than proteins? a. When a virus was radioactively labelled, and the virus was allowed to infect a bacteria cell, radioactive virus DNA was found inside the bacteria cell while radioactive virus proteins were found outside the cell. b. Dead pathogenic bacteria cells combined with living nonpathogenic bacteria cells caused the creation of living pathogenic cells and thus the death of the host animal. c. Proteins are a class of macromolecules with the diversity and specificity needed for hereditary material. d. Nucleotide bases occur regularly, such that the number of adenines = number of thymines, and the number of guanines = number of cytosines.
Some DNA vaccines use a brief and small electrical shock to get DNA in plasmids into cells. What advantage would there be in using DNA vaccines that consist of plasmids instead of just pieces of double-stranded DNA? The new Covid19 vaccine produced by two companies (Pfizer, Moderna) uses mRNA coding for part of the spike protein of the virus. The virus uses the spike protein to invade human cells where it replicates. Is it surprising that the mRNA must be stabilized with chemicals that need ultra-cold or frozen storage to protect the mRNA from degradation before it causes human muscle cells to make the spike protein? Why not just inject the double-stranded cDNA that codes for the spike protein of the virus? What additional step or steps would you need to use to get the human muscle cells to produce the spike protein if the cDNA was injected to serve as the virus?
A genetics instructor designs a laboratory experiment to study the effects of UV radiation on mutation in bacteria. In the experiment, the students spread bacteria on petri plates, expose the plates to UV light for different lengths of time, place the plates in an incubator for 48 hours, and then count the number of colonies that appear on each plate. The bacteria that have received more UV radiation should have more pyrimidine dimers, which block replication; thus, fewer colonies should appear on the plates exposed to UV light for longer periods. Before the students carry out the experiment, the instructor warns them that while the bacteria are in the incubator, the students must not open the incubator door unless the room is darkened. Why should the bacteria not be exposed to light?
the human immunodeficiency virus HIV uses RNA rather than DNA to encode genetic information. During infection, however, HIV uses an enzyme known as reverse transcriptase to generate double-stranded DNA. Generally speaking, how would the enzyme generate a double strand of DNA from a single strand of RNA?
After entering cells, viruses use the host cell machinery to transcribe their viral DNA into RNA or make new copies of their RNA, which will then be translated into proteins that are needed for virus function and replication. There has been a lot of interest and some progress in the development of anti-viral drugs that act to halt the viral replication cycle. Do you think it would effective to target a drug to cellular RNA polymerase to halt viral replication? Why or Why not?
Draw replication forks that show what you would expect to see if a cell were unable to make the following enzymes: DNA Polymerase Helicase Primase Ligase
You are studying a new virus with a DNA genome of 12 Kb. It can synthesize DNA at a rate of 400 nucleotides per second. If the virus uses rolling-circle replication, how long will it take to replicate its genome? Answer only for the first strand; ignore replication along the displaced strand. O 7.5 seconds O 15 seconds O 30 seconds O 1 minute O 2 minutes
The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left side
How does DNA replication occur in a precise manner to ensure that identical genetic information is put into the new chromatid? See Figures 8.12 and 8.13. FIGURE 8.12 In DNA replication, the two polynucleotide strands uncoil, and each is a template for synthesizing a new strand. A replicated DNA molecule contains one new strand and one old strand. This mechanism is called semiconservative replication. FIGURE 8.13 A close-up look at the process of DNA replication. (a) As the strands uncoil, bases are added to the newly synthesized strand by complementary base pairing with bases in the template strand. The new bases are linked together by DNA polymerase. (b) DNA synthesis can proceed only in the 5 3 direction; newly synthesized DNA on one template strand is made in short segments and linked together by the enzyme DNA ligase.
Given the following stretch of mRNA, what would be the sequence of the corresponding non-template DNA? 5' - UUG-CAA-UCG-CAG-UGC-CGC-AUA-GAU - 3' Group of answer choices 3' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 5' 5' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 3' 5' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 3' 3' - AAC-GUU-AGC-GUC-ACG-GCG-UAU-CUA - 5' 3' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 5'
During the process of protein synthesis on a ribosome, when the large ribosomal subunit covalently attaches an amino acid to a growing polypeptide, what is the name of this newly formed covalent bond? the phosphodiester bond the peptide bond the aminoacyl bond the ether bond the glycosidic bond The ability of F+ cells, or Hfr cells, to transfer plasmid DNA to an F- cell is properly called: transversion transformation conjugation transduction transition