During the process of protein synthesis on a ribosome, when the large ribosomal subunit covalently attaches an amino acid to a growing polypeptide, what is the name of this newly formed covalent bond? the phosphodiester bond the peptide bond the aminoacyl bond the ether bond the glycosidic bond The ability of F+ cells, or Hfr cells, to transfer plasmid DNA to an F- cell is properly called: transversion transformation conjugation transduction transition

During the process of protein synthesis on a ribosome, when the large ribosomal subunit covalently attaches an amino acid to a growing polypeptide, what is the name of this newly formed covalent bond? the phosphodiester bond the peptide bond the aminoacyl bond the ether bond the glycosidic bond The ability of F+ cells, or Hfr cells, to transfer plasmid DNA to an F- cell is properly called: transversion transformation conjugation transduction transition

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Assume the following DNA template strand: 3'-ATA GCG AGG AGT ATC-5' A) What would be the protein associated with this DNA template strand? Give the sequence of amino acids encoded by this fragment. Leave traces of your steps. B) In the synthesis of this protein, what are the codon and the anticodon for? Explain in one sentence for each. C) We find, in another cell, a mutation of this DNA template strand: 3' ATA GCG TGG AGT ATC-5’ 1. What type of point mutation is it? 2. Did this mutation arise during transcription, translation or DNA replication? D) If this mutation is found in a spermatozoon, will it have an effect on the individual, its offspring or both? Briefly explain
Given a sequence of a DNA coding strand: 5’-ATGATTATCCTATAG-3’ What is the sequence and direction of the mRNA strand synthesized from this DNA?
Most laboratory strains of E. coli contain site-specific DNA methylases. The methylase encodedby the dam gene (Dam methylase) transfers a methyl group from S-adenosylmethionine (SAM) tothe N6 position of the adenine residues in the sequence GATC. The Dcm methylase (encoded bythe dcm gene) methylates the internal cytosine residues in the sequences CCAGG and CCTGG atthe C5 position.The E. coli strain used in this experiment is mutated so Dcm and Dam methylases are notfunctional. What is the advantage of using dcm or dam mutants when the E. coli will be a host torecombinant DNA? HINT – If the E. coli methylates the DNA in these cells, then how would thisaffect the activity of restriction endonucleases
The following sequence is a double stranded DNA. 5'ATTTGACAATGCGTTAGGCATGACTATGTATAATGCATGCCACATACT... 3' 3'TAAACTGTTACGCAATCCGTACTGATACATATTACGTACGGTGTATGA…5' -35 -10 +1 Where does RNA polymerase initially binds?
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
A DNA-binding protein recognizes the following double-strandedsequence:5′–GCCCGGGC–3′3′–CGGGCCCG–5′This type of double-stranded structure could also occur withinthe stem region of an RNA stem-loop. Discuss the structural differencesbetween RNA and DNA that might prevent the DNAbindingprotein from recognizing a double-stranded RNA molecule.
Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the coding sequence of the DNA is replaced with a cytosine (as illustrated below). Original sequence (coding strand): AGTTCCTACAAAATGGAGCTGTCTTGGCATGTAGTCTTT ...[Sequence continues with another 80 bases] New sequence: AGTTCCCACAAAATGGAGCTGTCTTGGCATGTAGTCTTT...[Sequence continues with another 80 bases] UAC encodes tyrosine, CAC encodes histine, per the coding table. (This question can be answered without use of the code table, but it is provided here as a resource.) What would the expected result of such a mutation be on the final protein product of the mutated gene (compared to the original, non-mutant product)? The protein will be very different from the original version, and likely non-functional. The protein will be cut short, ending after the first amino acid. There will be no protein produced at all. No change – the protein will be the same.…
A small section of a gene for a protein has the following nucleotide sequence:CTG GGA TCC TAA GGTWhich of the following mutations would cause a nonsense mutation in the sequence shown above? Select one: a. Replacement of second adenine base with a cytosine base b. Insertion of guanine base after the first thymine base c. Insertion of guanine base after the first adenine base d. Replacement of second cytosine base with a adenine base
In a bacterial culture in which all cells are unable to synthesizeleucine (leu-), a potent mutagen is added, and the cells areallowed to undergo one round of replication. At that point, samplesare taken, a series of dilutions are made, and the cells areplated on either minimal medium or minimal medium containingleucine. The first culture condition (minimal medium) allowsthe growth of only leu+ cells, while the second culture condition(minimal medium with leucine added) allows growth of all cells.The results of the experiment are as follows: Culture Condition Dilution ColoniesMinimal medium 10-1 18Minimal medium + leucine 10-7 6What is the rate of mutation at the locus associated with leucinebiosynthesis?
Given the following coding sequence for DNA, provide the sequence of the complementary(template) sequence. 5’ ATGCATAGATTAGGATATCCCAGATAG 3’
Two circular DNA molecules, which we can call molecule A andmolecule B, are topoisomers of each other. When viewed under theelectron microscope, molecule A appears more compact than molecule B. The level of gene transcription is much lower for molecule A. Which of the following three possibilities could accountfor these observations?First possibility: Molecule A has three positive supercoils, andmolecule B has three negative supercoils.Second possibility: Molecule A has four positive supercoils, andmolecule B has one negative supercoil.Third possibility: Molecule A has zero supercoils, and molecule Bhas three negative supercoils.
Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?