Why Sanger sequencing uses ddNTPs and how they differ functionally from dNTPs. Does Sanger sequencing minimize the length of replication since phosphodiester bonds are not forned during DNA replication. Also, does it differ from dNTPs functionally since it lacks two hydroxyl groups?

Why Sanger sequencing uses ddNTPs and how they differ functionally from dNTPs. Does Sanger sequencing minimize the length of replication since phosphodiester bonds are not forned during DNA replication. Also, does it differ from dNTPs functionally since it lacks two hydroxyl groups?

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 8P: Human Genome Replication Rate Assume DNA replication proceeds at a rate of 100 base pairs per second...

See similar textbooks

Related questions

Q: Composition as a mole fraction of one of a double-stranded DNA strand T = 0.22 and C = 0.30. In the…

A: Nucleic acids are the units of DNA or gene or chromosome. Genetic variation occurs due to…

Q: The inability of DNA polymerase to replicate the ends of linear chromosome in one strand, compare…

A: Introduction The biological process of producing two identical copies of DNA from a single original…

Q: 5'- -3'

A: The mechanism by which a double-stranded DNA molecule is replicated to create two equivalent DNA…

Q: DNA ligase catalyzes the formation of a peptide bond without adding another nucleotide to the…

A: The DNA backbone is made up of deoxyribose sugar and phosphate groups. The phosphate group joins two…

Q: Just question 33

A: The error in the cell at the time of replication generally does not cause cancer as they are…

Q: What is the importance of the 3' to5' exonucleasevactivity of DNA polymerase

A: Enzymes serve as biological catalysts that fasten the rate of reaction by lowering the activation…

Q: Three types of important sequences found in bacterial origin of replication.

A: The origin of replication (or replication origin) is essentially an specific sequence in a genome…

Q: Norflaxacin is a cidal broad spectrum antibiotic that functions by inhibiting DNA gyrase in gram +/-…

A: Norfloxacin is a broad-spectrum fluoroquinolone antibiotic, which is used to treat UTI (urinary…

Q: Explain how cells activate nucleic acids for polymerization.

A: Nucleic acids are polymers themselves. A macromolecule such as a nucleic acid or protein is…

Q: Replication of a circular DNA molecule can occur by either theta replication or by rolling circle…

A: DNA replication is a process that occurs in all living organisms. In this process, DNA strands of…

Q: Suggest a reason why it would be unlikely for replication to take place without unwinding the DNA…

A: Nucleic acids are the major class of biomolecules that are important for all forms of the organism.…

Q: Which of the following is true of DNA repair?

A: DNA repair is the process by which a cell identifies any damage in the DNA and rectifies it. It is…

Q: Describe the Okazaki fragment and its formation in one of the strands of DNA essentiality of their…

A: Only while each strand of DNA is separated from an additional can DNA polymerase activity continue…

Q: The binding of the SSB (single-stranded binding) protein with DNA (deoxyribonucleic acid) and still…

A: Only when both strands of DNA are been allows to separated from one other can state the DNA in the…

Q: All known DNA polymerases catalyze synthesis only in the 5' → 3' direction. Nevertheless, during…

A: DNA replication is the process of making two identical copies of DNA. The process is carried by the…

Q: Justify why the absorption of UV light by double-stranded DNA rises when the DNA is denatured (the…

A: Hyperchromicity is the result of a molecule's increased absorbance.

Q: Explain why DNA replication requires RNA primers. What do they do and why do they have to be…

A: The process of duplicating a double-stranded DNA molecule into two identical DNA molecules is known…

Q: Central Dogma Application: Using the basic concept of Process of central dogma provide the following…

A: According to the central dogma, the most common pattern of information in our cells is: From…

Q: Suppose Meselson and Stahl had done theirexperiment the other way around, starting with cells fully…

A: Introduction: Meselson and Stahl conducted an experiment with the E.coli DNA which proved the…

Q: A mixture of four a-[*p]-labeled ribonucleoside triphosphates was added to permeabilized bacterial…

A: (a)By adding in excess unlabeled rNTPs, the labeled rNTPs that were added previously will stop being…

Q: The double helix structure of deoxyribonucleic acid (DNA)

A: The characteristic features of an individual is controlled by the genes in DNA. The arrangement of…

Q: The most important features of DNA (deoxyribonucleic acid) replication.

A: Introduction The biological process of making two identical duplicates of DNA from a single original…

Q: How many subunits does the E. coli DNA polymerase I have? Soloct onot

A: Option(d) 1

Q: I need question 31

A: Tautomeric shifts in nucleotide bases The purine and pyrimidine bases in DNA exist in two different…

Q: Refer to the attached figure and label the 3 secondary conformations of DNA (i-iii) and discuss…

A: Deoxyribonucleic acid (DNA) is the hereditary molecule in most organisms except the retroviruses,…

Q: Question Which of the following activities of DNA pol lis MOST important in proofreading A 5' to 3'…

A: The DNA replication in the newly added base are read by DNA pol I enzyme to check weather the added…

Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…

A: DNA replication is a phenomenon in which DNA make itself using Enzyme DNA Polymerase . It occurs in…

Q: 3r 5' C ACAA AGGAAT Primer 5'-CUU-3' is being used to replicate this piece of DNA. What strand this…

A: DNA is a nucleic acid with deoxyribose sugar that is responsible for the inheritance of traits. The…

Q: (a) Eukaryotic DNA replication is more complex than prokaryotic replication. Give one reason why…

A: a. Eukaryotic DNA replication is more complicated than prokaryotic replication because of the…

Q: Spontaneous deamination of cytosine bases in DNA takes place at low but measurable frequency.…

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: Structure of DNA double helix

A: Introduction The genetic material in humans and virtually all other species is called…

Q: Which of the following reactions is required for proofreading during DNA replication by DNA…

A: DNA polymerase III is the primary enzyme complex which is involved in prokaryotic DNA replication.…

Q: DNA Replication For the following piece of DNA, draw the replicated piece of DNA the original and…

A: DNA replication is a process by which one molecule of DNA replicates and results in two daughter DNA…

Q: Escherichia coli's chromosome has a replication origin called OriC. Draw a schematic diagram to show…

Q: The semi discontinuity in DNA replication. Is it biologically possible for DNA to undergo…

A: Polymerase chain reaction (PCR) is in-vitro DNA synthesis technique. In PCR replication is not…

Q: Describe DNA replication. What are Okazaki fragments? Why does each chromosome have thousands of…

A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…

Q: Single-strand binding proteins keep the two parental strands of DNA separated from each other until…

A: Deoxyribonucleic acid or DNA is the genetic material that is passed on from the parents to the…

Q: The binding of the SSB (single-stranded binding) protein with DNA (deoxyribonucleic acid) and still…

A: Introduction A single-stranded binding protein can be outlined as the proteins that are present in…

Q: Why does DNA replication only occur in the 5’ to 3’ direction? (A) 5' 3' (B) 5' 3' Should be PPP…

A: The central dogma of the cell is the process of the transfer of genetic material from DNA to…

Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…

A: The sense strand is the DNA strand that has the same sequence as mRNA, which uses the antisense…

Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…

A: A sense strand, also known as a coding strand, is a stretch of double-stranded DNA that carries the…

Q: In both leading and lagging strand synthesis, DNA replication always proceeds in a certain…

A: "Since you have asked multiple questions, according to Bartleby's guidelines we are eligible to…

Q: What are the advantages of the DNA utilizing thymine in respect of a low error during replication of…

A: DNA replication is the process of making DNA from a DNA strand. It involves many enzymes and stages.…

Concept explainers

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.

Question

Why Sanger sequencing uses ddNTPs and how they differ functionally from dNTPs.

Does Sanger sequencing minimize the length of replication since phosphodiester bonds are not forned during DNA replication.

Also, does it differ from dNTPs functionally since it lacks two hydroxyl groups?

Definition Definition Mechanism by which deoxyribonucleic acid (DNA) is capable of producing an exact copy of itself. DNA molecules utilize a semiconservative method for replication. DNA replication is the most essential part of biological inheritance and is crucial for cell division during growth and repair of damaged tissues.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The semi discontinuity in DNA replication. Is it biologically possible for DNA to undergo replication in vivo, without the lagging and the leading strands? In PCR, we also start with an antiparallel strand of DNA. Does this also mean that replication is semidiscontinuous in in vitro replication?
Why is DNA not soluble in ethanol whereas other components cells are soluble. What is the rationale behind DNA precipitation in solution
DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OH
Not just generic "degradation" or even shorter DNA fragments, what specific structure change in double-stranded DNA does the hyperchromicity effect show?
(a) Eukaryotic DNA replication is more complex than prokaryotic replication. Give one reason why this should be so. (b) Why might eukaryotic cells need more kinds of DNA polymerases than bacteria?
Replication of a circular DNA molecule can occur by either theta replication or by rolling circle replication. Describe or explain three differences between these two modes of DNA replication. Be VERY specific and accurately describe the differences between the two.
there is nucleotide selectivity during replication, why do polymerase choose a wrong nucletide and the reaction can go on with the mistake?
Which of the following DNA double helices would be more difficultto separate into single-stranded molecules by treatment withheat, which breaks hydrogen bonds?A. GGCGTACCAGCGCATCCGCATGGTCGCGTAB. ATACGATTTACGAGATATGCTAAATGCTCTExplain your choice.
Justify why the absorption of UV light by double-stranded DNA rises when the DNA is denatured (the hyperchromic effect).
DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG−OH Match the items in the left column to the appropriate blanks in the sentence on the right.
The direction of movement of RNA polymerase along the template to generate supercoiled structures in reference to the given figure and whether supercoils would be generated if RNA polymerase were free to rotate about the DNA axis.
Depurination of purine bases results in an apurinic site. Assume a single depurination event occurs in the GC base pair of the sequence below and is not repaired. Then, if two rounds of replication occur, which of the following DNA sequences will exist after two rounds of replication? Remember that when DNA polymerases encounter an apurinic site, most often an A is incorporated into the newly synthesized strand. Assume this is true for the sequence below. ...TACT... ...ATGA... Question 7 Select one or more: ...TAGT... ...ATCA... 1. ...TACT... ...ATGA... 2. ...TAAT... ...ATTA... 3. ...TAAT... ...AT_A... 4. ...TA_T... ...ATAA... 5. ...TATT... ...ATAA...