You are working with a newly discovered mutagen, and you wish to determine the base change that it introduces into DNA. Thus far, you have determined that the mutagen chemically alters a single base in such a way that its base-pairing properties are altered permanently. To determine the specificity of the alteration, you examine the amino acid changes that take place after mutagenesis. A sample of what you find is shown here:Original: Gln–His–Ile–Glu–LysMutant: Gln–His–Met–Glu–LysOriginal: Ala–Val–Asn–ArgMutant: Ala–Val–Ser–ArgOriginal: Arg–Ser–LeuMutant: Arg–Ser–Leu–Trp–Lys–Thr–Phe

You are working with a newly discovered mutagen, and you wish to determine the base change that it introduces into DNA. Thus far, you have determined that the mutagen chemically alters a single base in such a way that its base-pairing properties are altered permanently. To determine the specificity of the alteration, you examine the amino acid changes that take place after mutagenesis. A sample of what you find is shown here:Original: Gln–His–Ile–Glu–LysMutant: Gln–His–Met–Glu–LysOriginal: Ala–Val–Asn–ArgMutant: Ala–Val–Ser–ArgOriginal: Arg–Ser–LeuMutant: Arg–Ser–Leu–Trp–Lys–Thr–Phe

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 12TYU

See similar textbooks

Similar questions

"The molecule serving as the genetic material is expected to absorb at the wavelengths shown to be mutagenic." Explain this statement ?
You are studying the tryptophan synthetase gene that Yanofsky also examined to determine the relationship between the nucleotide sequence and the amino acid sequence of the gene. Yanofsky found a large number of mutations that affected the tryptophan synthetase gene. A) If you took this mutant E. Coli line (that has an Arginine at this location) and exposed it to a mutagen that could potentially change bases, what are the second mutations you would most likely discover that would restore the activity of the tryptophan synthetase gene and where would it be located? B) Most of the mutations that Yanofsky recovered were missense mutations. However, Yanofsky also recovered a nonsense mutation that changed amino acid number 15 into a stop codon. This codon normally encodes Lysine. Does the recovery of this mutation support the hypothesis that this Lysine residue is critical in the function of the tryptophan synthetase protein?
If the mutation causing Tay Sachs disease involves a C to T change at position 4 in the sequence AAGCGTTAGCTAGGCC, what probe would you use to detect the mutation in individuals concerned about carrying the disease?
Shown below are two homologous lengths of the alpha and betachains of human hemoglobin. Consult a genetic code dictionary and determine how many amino acid substitutionsmay have occurred as a result of a single nucleotidesubstitution. For any that cannot occur as a result of a singlechange, determine the minimal mutational distance. Alpha: ala val ala his val asp asp met proBeta: gly leu ala his leu asp asn leu lys
You are working with a newly discovered mutagen, andyou wish to determine the base change that it introduces into DNA. Thus far, you have determined that themutagen chemically alters a single base in such a waythat its base-pairing properties are altered permanently.To determine the specificity of the alteration, you examine the amino acid changes that take place after mutagenesis. A sample of what you find is shown here:Original: Gln–His–Ile–Glu–LysMutant: Gln–His–Met–Glu–LysOriginal: Ala–Val–Asn–ArgMutant: Ala–Val–Ser–ArgOriginal: Arg–Ser–LeuMutant: Arg–Ser–Leu–Trp–Lys–Thr–PheWhat is the base-change specificity of the mutagen?
There are five substitution mutations in the dark-colored mutant Mc1r gene. Compare the DNA sequence of the light-colored wild-type Mc1r gene with the DNA sequence of the dark-colored mutant Mc1r gene. Indicate the locations of the five mutations by changing the font color to YELLOW for the five single DNA nucleotides that are mutated in the mutant Mc1r gene table. Using the information in the introduction, determine whether each of these mutations is a silent, missense, or nonsense mutation. Using the mutant Mc1r gene data, fill in the columns (including DNA, mRNA, and amino acid) in gene table 2 that contain a silent mutation with BLUE. Likewise, fill in the columns that contain a missense mutation with RED. Shade any columns that contain nonsense mutations with GREEN. Then Of the five mutations you identified in the mutant Mc1r gene, how many are: substitutions insertions deletions (Enter a number on each line.) 2. Of the five mutations…
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
A normal hemoglobin protein has a glutamic acid at position 6; in sickle-cell hemoglobin, this glutamic acid has been replaced by a valine. List all the possible mRNA codons that could be present for each type of hemoglobin. Can a single base change result in a change from Glu to Val in hemoglobin?
As part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. 1. What technique could you use to confirm that you are obtaining a shortened version of your intended protein? explain
A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through c. For Mutant 1: Met-Ser-Pro 1) indicate what change has occurred at the DNA leve! 2) identify the specific type of mutation that occurred in the DNA (single base substitution, frameshift (insertion, deletion), 3) indicate the phenotypic effect of the mutation (nonsense, etc.). Show all work.
The E. coli genome contains 1009 Chi sequences. Do these sequences occur at random, and, if not, how much more or less frequently than random do they occur?
In studies of the amino acid sequence of wild-type and mutant forms of tryptophan synthetase in E. coli, the following changes have been observed: Determine a set of triplet codes in which only a single-nucleotide change produces each amino acid change.