You have isolated a new protein called STICKY. You can predict from comparisons with other known proteins that STICKY contains a bHLH domain. Predict the function of STICKY and rationale forthe importance of these domains in STICKY function.

Q: You have isolated a new protein called STICKY. You can predict from comparisons with other known…

A: The structural motifs are super secondary structures that are found on nucleic acids or protein…

Q: xplain how hydrophobic effect influence protein structure and gene expression.

A: The hydrophobic effect is the inclination of non-polar molecules and molecular portions in a…

Q: AGGTATCGCAT is a sequence from the coding strand of a gene. What will bw the corresponding sequence…

A: The terms used in the question represents the molecules used during a gene expression. A gene is a…

Q: ins that mady De (A) constitutive proteins B B isoforms C spliceosomes

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: Below is a sequence of mRNA. Use it to answer the questions below. 5' -…

A: The central dogma in both prokaryotic and eukaryotic cell consists of a series of steps including…

Q: Illustrate the Analyze protein structure, and predict protein functionson the basis of identified…

A: Proteins are made up of amino acid chains. Protein domains are conserved polypeptide regions that…

Q: Interpret this mRNA strand and determine the proper sequence and shape of this protein:  AUG UCA CGC…

A: Introduction :- When transcription occurs, mRNA is produced. RNA polymerase decodes a single strand…

Q: A mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to…

A: Mutations are abrupt changes in DNA only one ways has been changed the original DNA.

Q: You are a researcher who has just discovered a new protein in a fungus. Design a yeast two-hybrid…

A: It is given that a new protein is discovered in the fungus. This new discovered protein interacts…

Q: the code relating DNA to protein.2. Summarize the evidence showing that the sequence ofnucleotides…

A: Collinearity defines that a continuous sequence of amino acids is encoded by a continuous sequence…

Q: the sequences od tRNA and corresponding mRNA  is complementary to each other. is the statement true…

A: The synthesis of a functional protein involves two processes namely transcription and translation.…

Q: This CGT ACT GCA TCA GGC sequence of nucleotides is a referred to as sequence

A: Every biomolecules is a polymer made from a number of monomers. DNAs are the polymers of…

Q: Use the table of the codons to answer the following question. Starting with the start codon, what is…

A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA molecule that codes for a…

Q: Explain how the genetic code stored within DNA determines the protein that will form

A: Proteins are the building blocks of cells and play crucial role in physiology due to the involvement…

Q: What are the two major molecules that make up ribosomal subunits? Recalling information from chapter…

A: Ribosomes are macromolecules found in abundant quantities in the cells of living cells. An actively…

Q: Would a chimeric translation system containing thelarge ribosomal subunit from E. coli and the small…

A: The chimeric translation system is the translation process that uses two different ribosomal…

Q: These all relate to the translation of genetic informationstored in mRNA into proteins and how…

A: The highly diverse form of protein structure present in all cells are known as Ribosomes. In…

Q: Suggest an explanation for the observation that when proteins are chemically modified so that…

A: A polypeptide chain is made on cellular structures, called the ribosomes. This is done by a complex…

Q: A protein has the opnino acid seruence that cates as follows: •N-terminas - Some More amino kids -…

A: Protein targeting or also called as protein localization is the process by which proteins get…

Q: Explain how FtsZ and tubulin proteins are examples of homology

A: Evolution is the process of gradual changes occurring in the species over a period of time, when the…

Q: Gene mutations ultimately alter protein structure. In whichregion of a carrier protein would a…

A: Protein structures are translated from the DNA present in the nucleus of the cell. DNA will be…

Q: Relate the structure of the three RNA to their function in building of Polypeptide and point out the…

A: Nucleic acids, Deoxyribonucleic acid(DNA), and ribonucleic acid(RNA) are composed of monomers termed…

Q: Briefly describe four ways in which a protein could be denatured.

A: Denaturation is a process in which proteins lose their native conformation i.e. normal, biologically…

Q: Discuss how mutations impact protein function. Namely hypothesis the affect these particular…

A: Mutations, variations in a gene's DNA sequence, occur in nature spontaneously. Since alleles are…

Q: During protein synthesis, one amino acid binds to RNA molecules. a) What is this RNA molecule? b)…

A: The process of formation of Amino acids from mRNA molecule is known as translation.

Q: nucleotide sequence has providen to you, you have only the name of source organism. - how will you…

A: For finding the nucleotide sequence for proteins first Use the NCBI BLAST service to perform a…

Q: Use the following DNA sequence, and write the resulting messenger RNA sequence

A: When DNA makes it's two copies then this is called replication. When DNA is converted into RNA then…

Q: Sometimes knowing the DNA sequence of a gene that codes for a protein does not tell you the amino…

A: A DNA sequence is copied into a messenger RNA in the process of transcription that occurs in the…

Q: B-barrel proteins often create pores in cellular membranes. What kind of amino acids are likely to…

A: In protein structures, a beta barrel is a beta-sheet composed of tandem repeats that twists and…

Q: Consider à ollowing sequence: His-Cys-Leu-lle-Met where Met is at the C-terminus end. Based on the…

A: Amino Acids are are structures linked by Peptide Bonds to Form Polypeptide Chains. Proteins are…

Q: What can you infer about the structure and cellular localization of the protein below based on its…

A: The relative property of each amino acid of a protein has been demonstrated experimentally by…

Q: onstruct and explanation based on evidence of how the structure of DNA determines the structure of…

A: According to the central dogma of molecular theory, the information stored in the DNA is first…

Q: Construct a multiple protein sequence alignment using human HOXD13 and 9 other orthologues of human…

A: All the 4 proteins are paralogous because they are decants from the same ancestor group but they…

Q: Describe one molecular strategy that is used in RNA structures to bring the negatively charged…

A:

Q: what us bZIP and bHLH protein domains? how are they similar? how are they different?

A: Enzymes can bind to DNA to regulate different processes of DNA by certain motifs .

Q: Analysis of the evolution of proteins reveals that Glycine and Cystiene are often conserved. For…

A: Conserved amino acids is an amino acid sequence in a protein that has remained essentially…

Q: A segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What…

A: Translation is the mechanism by which ribosomes in the cytoplasm or endoplasmic reticulum synthesize…

Q: Explain how a protein ensures that it binds specifically to only a certain region of DNA and not…

A: DNA binding proteins have structural compatibility by the presence of DNA binding domains which make…

Q: . ) In one (1) sentence point out a key structural similarity and difference in each of the…

A: Biomolecules are abundant biological molecules present in the body like carbohydrates, proteins,…

Q: =Suggest, which part of these sequence referred to inner core of the otein/ outer core (use single…

A: Hydrophobic: A, C, I, L, M, F, W, V. Neutral: G, H, P, S, T, Y. Hydrophilic: R, N, D, Q, E, K

Q: • In a globular protein, where would you expect the nonpolar regions to be located? Whereabouts…

A: Proteins are classified into two main groups based on their Molecular shape. They are 1) Globular…

Q: Can you hypothesize why a mixtureof (Poly U)+(Poly A) would not stimulate incorporation…

A: The copolymer experiment was developed in the 1960s by Gobind Khorana who chemically synthesize long…

Q: Differentiate between a conserved hypothetical protein and a putative protein of unknown function

A: Proteins are one of the major biological macromolecules responsible for performing major functions…

Q: A protein had the amino acids leu-gly at codons 10 and 11. A deletion of the 5’ base of the leu…

A: Codons are trinucleotide sequences and it codes for specific amino acids. The human genome contains…

Q: Given the mRNA for a protein: 5'–CCGAACGAUGGGCUAUCCCUAACCGUUU --- 3' Write the amino acid sequence…

A: DNA is the genetic material that gets transcribed into mRNA by an RNA polymerase enzyme. The…

Q: d. Which amino acid is represented by (6)? e. Give the one anticodon in the 5' to 3' direction that…

A: In this question, we are shown the process of protein formation from a DNA sequence. This takes…

Q: One remarkable feature of the genetic code is that amino acids with similar chemical properties…

A: Introduction :- The genetic code is made up of codons, which are three-letter nucleotide pairings…

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.