Construct a multiple protein sequence alignment using human HOXD13 and 9 other orthologues of human HOXD13. In the figure legend, describe what is being shown, and specify the size (start and stop number of amino acid) and location of conserved domain(s) in HOXD13 level: UNI

Construct a multiple protein sequence alignment using human HOXD13 and 9 other orthologues of human HOXD13. In the figure legend, describe what is being shown, and specify the size (start and stop number of amino acid) and location of conserved domain(s) in HOXD13 level: UNI

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1VQ

See similar textbooks

Related questions

Q: Fill in the space _____________ repeats are structural motifs found in many proteins, and they…

A: Beta pleated sheet is the correct answer

Q: includes

A: A new Covid, known as serious intense respiratory disorder Covid 2 (SARS-CoV-2), is the aetiological…

Q: Consider the peptide with the sequence SANTACLAUSISASTALKER. Assume this entire pepide were a single…

A: Proteins are the heteropolymers of amino acids. The proteins are made up of twenty standard amino…

Q: Using the provided coding strand below: 5-ATCAGATGGCCGGGCCAATAGAATAGCTGT-3 What is the name (word)…

A: The name of the animal specifically it's a bird that s represented if we transform the 3-letter…

Q: Examine the following coding strand DNA nucleotide sequence,representing the complete gene sequence…

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: A…

Q: Sir Bong wanted to determine the a amino acide sequence og BONG. The summary of the analyses…

A: Since you have posted a question with multiple sub-parts, we will solve first three subparts for…

Q: Suppose you performed two BLAST searches, one on the peptide sequence FIDPWE, and another on the…

A: BLAST is a computer algorithm that is available for use online at the National Center for…

Q: Below is a sequence of DNA.…

A: The process of identifying the coding region and the position of a gene in a genome is known as gene…

Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…

A: The proteins are the final end product of a gene that ultimately determine the characteristics of an…

Q: What are some of weaknesses of BLASTP searching and Conserved Domain searching for protein…

A: Bioinformatics is an interdisciplinary field of study which has diverse application in the field…

Q: . Disulfide bonds have been shown to stabilize proteins (i.e., make them less likely to unfold).…

A: In disulfide linkage, the two cysteine amino acids are joined by a disulfide bond.

Q: What are the possible codons that a tRNA molecule could interact with if it is carrying each of the…

A: A codon is a triplet nucleotide of DNA or RNA corresponding during protein synthesis to a particular…

Q: Disulfide bonds have been shown to stabilize proteins (i.e., make them less likely to unfold).…

A: Disulfide bonds are considered the covalent bond, which is formed between the two cysteine residues.…

Q: A comparison of the aligned amino acid sequences of two proteins each consisting of 150 amino acids…

A: In the given case both the proteins can be of related population so, the proteins can be related by…

Q: Write the names of the appropriate regions on L-shaped structure of TRNAS. 13' 15'

A: The process of protein synthesis involves transcription and translation. In transcription, DNA is…

Q: Suppose you performed two BLAST searches, one on the peptide sequenceFIDPWE and another on the…

A: The Expect value (E) is a parameter that defines the number of hits that can be expected to be seen…

Q: True or False Degeneracy of Genetic Code: 1. a given amino acid has more than one codon 2. the…

A: True or False Degeneracy of Genetic Code: 1. a given amino acid has more than one codon 2. the…

Q: GTTTTCACTGGCGAGCGTCATCTTCCTACT 9. Generate a FULL protein sequence alignment for one of the…

A: Introduction Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…

Q: GTTTTCACTGGCGAGCGTCATCTTCCTACT 5. Calculate molecular weight (kiloDalton, kD) and calculated pI…

A: Hi! Thanks for your question. As you have posted multiple questions, we are answering the first two…

Q: Identify which regions of DNA encode the protein sequence. Consider that there may be introns (which…

A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…

Q: For the following five sequences, what is the consensus sequence? 5′–GGGAGCG–3′ 5′–GAGAGCG–3′…

A: Consensus sequences models are most used methods for sequencing base sequences. Consensus sequences…

Q: Find self-complementary regions in the following RNA sequence: AUGUGGCAUGCCAGG

A: Biomolecules includes carbohydrates, lipids, nucleic acids and proteins. Nucleic acid plays an…

Q: What secondary structural elements are most likely present in this sequence? Please annotate the…

A: Proteins are polymers of amino acids linked by peptide/amide bonds between the carboxyl group of one…

Q: Which of the following is the consensus sequence of the Kozak sequence?. O 5'AGGAGGU 3' 0 5 ТАТААТ…

A: Please follow step 2 for detailed explanation.

Q: What are some of the strengths of BLASTP searching and Conserved Domain searching for protein…

A: BLAST stands for Basic Local Alignment Search Tool. It is an online searching tool which is provided…

Q: In this exercise, you will compare the amino acid sequence from the aphid to the amino acid…

A: Acyrthosiphon (aphid) IKIIIIGSGV GGTAAAARLS KKGFOVEVYE KNSYNGGRCS IIR HNGHRF DQGPSL--YL Pantoea…

Q: Corn_AA DVVINHRCA---DYKDGRGIYCVFEGG---TPDSRLDWGPDMICSDDTQYSN--GRG 16 :: Figure: Sequence alignment…

A: Sequence alignment is defined as the arrangement of sequences of DNA, RNA, proteins to identify…

Q: If a new isolated protein called STICKY and this STICKY protein contains a bHLH domain. Now, how we…

A: Protein motifs are the distinct conserved small polypeptide sequence in proteins. These super…

Q: Proteins called molecular chaperones assist in the process of protein folding. One class of…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: Although ultimately coding for all aspects of a protein, the gene codes directly only for what level…

A: DNA is made up of many nucleotides. Each nucleotide is made up of phosphate , a pentose sugar, and…

Q: Why is it that sometimes you can identify some sequence similarity for protein sequences (i.e.,…

A: Actually BLAST means Basic Local Alignment Search Tool which is a search program used to generate…

Q: Please answer fast Determine the amino acid sequences for the six open reading frames for this 9…

A: An amino acid is one of the structural blocks of a protein. A gene's DNA grouping decides the order…

Q: Figure shows a part of the sequence alignment of human and whale myoglobin proteins. Please explain…

A: The condition represented in the sequence alignment is amino acid replacement. In amino-acid…

Q: A partial amino acid sequence from the tick anti-coagulant protein is:…

A: The genetic code is a set of three-letter combinations of nucleotides called codons that corresponds…

Q: A) Based on the mRNA sequence below, provide the corresponding DNA template (5'-3') and protein…

A: DNA is the genetic material in humans. It carries information that is transferred from one…

Q: AAAGAGAAAAGAAUA to AAAGAGAAAUGAAUA. Suppose the codon sequence has a single base pair mutation If…

A: Introduction: Mutations are changes in the genetic material or character of an organism. It can…

Q: The arrangement of amino acids in the primary sequence affects the secondary, tertiary, flexibility,…

A: The sequence of amino acids in a protein (the primary structure) will determine where alpha helices…

Q: what is the anticodon sequence that would build this protein?

A: The process of formation of mRNA sequence from a DNA transcript is known as translation. In mRNA,…

Q: TGTACACATGTCCGAAACAGACTTACCGAA-5

A: For the given DNA Sequence , the translated mRNA is as follows_ 3'TGTACACATGTCCGAAACAGACTTACCGAA5'…

Q: The goal of structural proteomics project isa) To crystallize and determine the structure of as many…

A: Proteomics, a term derived from "protein" and "genomics," needs further definition, as do proteomics…

Q: Low-resolution X-ray diffraction analysis of a protein composed of long stretches of the sequence…

A: Fibroins are insoluble proteins that are present in silk produced by insects, such as the larvae of…

Q: You have discovered a novel protein that has a pl = 5.5. To study the functional properties of this…

A: In this mutation process, hydrophobic phenylalanine is replaced by the Histidine residue. Histidine…

Q: In the image below, the blue squiggly line represents a folded protein. There are two particular…

A: Protein is a nitrogenous organic macromolecule that is crucial to human health. It is responsible…

Q: Describe why this position in your protein is important and outline the effects the mutation will…

A: Any change in DNA is referred to as a mutation. Any heritable and genetic modification in the genome…

Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’, what is the sequence of the…

A: EXPLANATION: DNA utilizes four bases, adenine (A), guanine (G), cytosine (C), and thymine (T), in…

Q: Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the…

A: Transcription is the process in which the synthesis of RNA takes place by using deoxyribonucleic…

Q: Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC What human disease has been connected to this gene?…

A: The given sequence CCACCTGTACCCGGACACACCCTGGTGTCC is a protein sequence that encodes the protein…

Question

Construct a multiple protein sequence alignment using human HOXD13 and 9
other orthologues of human HOXD13. In the figure legend, describe what is being
shown, and specify the size (start and stop number of amino acid) and location of
conserved domain(s) in HOXD13
level: UNI

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC What human disease has been connected to this gene? Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.
Which of the sequences below do you think would most likely be found in an intrinsically disordered protein? GSSKSSKKREPS MVLITTEVKAT MVLITTEVIIAA All of these could be found in an intrinsically disordered protein
A common strategy for identifying distantly relatedhomologous proteins is to search the database using a shortsignature sequence indicative of the particular proteinfunction. Why is it better to search with a short sequencethan with a long sequence? Do you not have more chancesfor a “hit” in the database with a long sequence?
Shown below is a portion of a DNA sequence ( 31 base pairs long ) that encodes the last amino acids of a protein : The first three underlined base pairs indicate the frame and include the coding region . 123456789 A. Write the peptide sequence of the last 6 amino acids of the protein . Label both ends of the peptide . B. A insertion of one base pair causes the protein to decrease in length by 5 amino acids . With respect to the sequence given above , where does this insertion occur , and what base pair will you insert ? C. An change of one base pair leads to the protein to increase in length by one amino acid. With respect to the sequence given above , which base pair would you change ? How would you change this base pair for the protein to increase in length by one amino acid ?
A comparison of the aligned amino acid sequences of two proteins each consisting of 150 amino acids reveals them to be only 8% identical. However, their threedimensional structures are very similar. Are these two proteins related evolutionarily? Explain
1. For each of the sequences given below, list what type of secondary structural element, if any is most likely to be formed by that amino acid sequence. 1a. SEGEWQLVLHVWA 1b. GKGPPGPPGPRGPC 1c. CHSRHPGDFSC 1d. ASVRMNLGF
A very common molecular biology research method is to analyze cell or tissue homogenates by SDS-polyacrylamide gel electrophoresis and immunoblotting (Western blot). What can we learn about a protein of interest from this type of analysis? More than one answer is correct. Options: Determine the tertiary structure of the protein of interest. Determine or verify the molecular weight of the protein of interest. Compare the levels of the protein of interest in two different cell types. Determine the amino acid sequence from the product ion spectrum. Determine the intracellular binding partners of the protein of interest.
Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
Describe the planar sections of the primary sequence, their influence on the shape of the protein backbone, and identify these sections given a drawing of the primary sequence.
How many binary sequences of length n contain at most five 1 digits? The genetic code specifies an amino acid through a sequence of three nucleotides. Each nucleotide can be of one of the four types T, A, C and G, beingrepetitions allowed. How many amino acids can be encoded in this way?And if there are n types. Compare
Shown below are two homologous lengths of the alpha and betachains of human hemoglobin. Consult a genetic code dictionary and determine how many amino acid substitutionsmay have occurred as a result of a single nucleotidesubstitution. For any that cannot occur as a result of a singlechange, determine the minimal mutational distance. Alpha: ala val ala his val asp asp met proBeta: gly leu ala his leu asp asn leu lys
You discovered a (tiny) novel protein and figured out that the protein sequence was: Met-Ala-Arg-Gly-Trp-Ala-Pro Work backwards (showing your work) to identify 2 possible DNA sequences that might encode your protein. Sequence 1: ______________________________________________________________________ Sequence 2: ______________________________________________________________________ Based on these sequences, is there anything you could infer about where this organism might live? Could the DNA in your possible sequences be beneficial for any particular environments?