ESSENTIALS OF GENETICS ALC & MOD MSTG/ET VP
1st Edition
ISBN: 9780134452890
Author: KLUG
Publisher: Pearson Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 10, Problem 22PDQ
Summary Introduction
To review:
An experiment similar to Taylor, Woods, and Hughes that unequivocally establishes the fact that DNA (deoxyribonucleic acid) replication is conservative in nature.
Introduction:
In the conservative mode of replication, the complementary chain of polynucleotides is synthesized. After the synthesis, the parental strands do not separate from each other instead reassociate following the replication and the newly synthesized strands come together and combined with each other. So in this mode of replication draughter strand is completely new DNA strand.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
What are the three models of DNA replication? With the aid of illustrations, show how the Meselson Stahl experiment come to the conclusion of one model of DNA replication.
Is DNA replication bidirectional? How did you arrive at this conclusion? Explain the bacterial replication model that supports this conclusion.
You conducted an experiment to determine the mechanism of DNA replication in the hypothetical organism Fungus mungus. Your data shows that synthesis of newly replicated DNA from F. mungus is discontinuous on both strands of the replication fork. Does this result support or not support the hypothesis that F. mungus replicates its DNA by the same mechanism as yeast?
Briefly explain your answer.
The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand?
5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3'
a) Both sides
b) Neither side
c) The right side
d) The left side
Chapter 10 Solutions
ESSENTIALS OF GENETICS ALC & MOD MSTG/ET VP
Ch. 10 -
CASE STUDY | At loose ends
A researcher was...Ch. 10 - Prob. 2CSCh. 10 - Prob. 3CSCh. 10 - Prob. 4CSCh. 10 - HOW DO WE KNOW? In this chapter, we focused on how...Ch. 10 - Review the Chapter Concepts list on p. 180. These...Ch. 10 - Compare conservative, semiconservative, and...Ch. 10 - Prob. 4PDQCh. 10 - Predict the results of the experiment by Taylor,...Ch. 10 - Prob. 6PDQ
Ch. 10 - Prob. 7PDQCh. 10 - Prob. 8PDQCh. 10 - Prob. 9PDQCh. 10 - Prob. 10PDQCh. 10 - Prob. 11PDQCh. 10 - Prob. 12PDQCh. 10 - Prob. 13PDQCh. 10 -
14. Distinguish between (a) unidirectional and...Ch. 10 - Prob. 15PDQCh. 10 - Define and indicate the significance of (a)...Ch. 10 - Outline the current model for DNA synthesis.Ch. 10 - Why is DNA synthesis expected to be more complex...Ch. 10 - Prob. 19PDQCh. 10 - Several temperature-sensitive mutant strains of E....Ch. 10 - Prob. 21PDQCh. 10 - Prob. 22PDQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Suppose that 28% of the nucleotides in a DNA moleculeare deoxythymidine 5′- monophosphate, and that duringDNA replication the percentage amounts of availablenucleotide bases are 22% A, 22% C, 28% G, and 28% T.Which base would be depleted first in the replicationprocess?arrow_forwardIf the sequence 5′-AACGC-3′ were damaged by reactive oxygen species, what would be the most prevalent product, and what would be the result of replication? (Note: show both strands after replication)arrow_forwardList and describe the steps in prokaryotic DNA replication. How does this process appear to differ from eukaryotic DNA replication?arrow_forward
- When DNA replication was investigated by using heavy, N15 DNA to mark the original molecules, and light, N14 DNA to mark the newly synthesized molecules, one band was found in the middle of the centrifuge column after one round of replication, and two bands were found (middle and top of column) after 2 rounds of replication. Imagine that after 1 round of replication 2 bands were found, one at the bottom and one at the top of the centrifuge column. In that case, what model of DNA replication would have been supported? The dispersive model The conservative model The Franklin model The semi-conservative modelarrow_forwardConsider the experiment conducted by Meselson and Stahl in which they used 14N and 15N in cultures of E. coli and equilibrium density gradient centrifugation. Draw pictures to represent the bands produced by bacterial DNA in the centrifuge tube before the switch to medium containing 14N and after one, two, and three rounds of replication in that medium. Use separate sets of drawings to show the bands that would appear if replication were (a) semiconservative; (b) conservative; (c) dispersive.arrow_forwarda) If you isolated DNA from the ear and the tail of the same mouse, would you expect the DNA, isolated from the two tissue types, to be the same? Why? b) Provide one difference between DNA replication in eukaryotes and prokaryotes with regard to their origin (s) of replication.arrow_forward
- The Meselson-Stahl experiment provided strong evidence that DNA replication was conservative, by alternately growing bacteria in medium with heavy 15N and light 14N. If DNA replication were dispersive, what result would Meselson and Stahl have observed after the first round of DNA replication in light nitrogen? Group of answer choices Two bands, one at the location for pure 15N and one at the location for pure 14N. One band, located half way between the locations for pure 15N and pure 14N. Two bands, one at the location for pure 15N and one located halfway between the locations for pure 15N and pure 14N. None of these Three bands, one at the location for pure 15N, one at the location for pure 14N, and one at a location halfway between.arrow_forwardSuppose that 22% of the nucleotides of a DNA molecule are deoxyadenosine and during replication the relative amounts of available deoxynucleoside triphosphates are 22% dATP, 22% dCTP, 28% dGTP, and 28% dTTP. What deoxynucleoside triphosphate is limiting to the replication? Explain.arrow_forwardBriefly discuss the pros and cons of having a nucleoid (as bacteria do) versus a double nuclear membrane surrounding the DNA (as in eukaryotes). List and explain three reasons why DNA replication is very accurate.arrow_forward
- With illustrative diagrams, explain the three theories of DNA replication..arrow_forwardThe proteins and enzymes listed below are all required for DNA replication in E. coli, but they are listed in a random order. Determine the correct order in which they function in replication, by selecting the correct number from the drop-down menu in each case, with 1 being first and 6 being last.arrow_forwardIn bacterial cells, nucleotide excision repair involves which of the following proteins? DNA glycosylase AP endonuclease photolyase AlkB UvrABC proteins If Meselson and Stahl had results from density gradient analysis of bacterial DNA that indicated only two bands, one of the original density and one that was the same as unlabeled DNA, and no intermediate density band, this would indicate that DNA replication is: constructive semiconservative conservative consecutive cannot determine from the information given 6.In E. coli, which DNA polymerase is primarily responsible for filling in the gaps in the DNA generated during nucleotide excision repair? DNA polymerase I DNA polymerase II DNA polymerase IV DNA polymerase V none of the abovearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license