EBK BROCK BIOLOGY OF MICROORGANISMS
15th Edition
ISBN: 8220103633352
Author: Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 10, Problem 2AQ
Replication of both strands of DNA in adenoviruses occurs in a continuous (leading) fashion. How can this happen without violating the rule that DNA synthesis always occurs in a 5′ → 3′direction?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
1) It is declared that some ribozymes are tightly
bound to proteins. What isn't the function of those
proteins?
Select one:
A) Regulate the enzymatic activities of the
ribozyme
B) Conduct the enzymatic function of the
ribozyme
C) Help the RNA fold properly
D) Stabilize the RNA and the ribozyme
2) What promotes the histone chaperone - CAF-I
aggregation to the replication machinery?
Select one:
A) Nucleosome tall modification
B) sliding DNA clamp
C) Clamp Loader
D) DNA polymerase
a) Under normal conditions E. coli produces three DNA polymerases. State their functional similarities and differences.
b) List the other proteins and enzymes involved in DNA replication in E.coli and give their functions.
Deamination of cytosine to form uracil can happen spontaneously during replication. It can be repaired relatively easily by
photoreactivation repair using DNA polymerase I
b)
base excision repair using DNA glycosylase creating an AP site
c)
base excision repair using topoisomerase creating an AP site
d)
none of these
Chapter 10 Solutions
EBK BROCK BIOLOGY OF MICROORGANISMS
Ch. 10.1 - Distinguish between a positive-strand RNA virus...Ch. 10.1 - Prob. 2MQCh. 10.1 - Prob. 3MQCh. 10.1 - Describe the classes of viruses based on their...Ch. 10.2 - Prob. 1MQCh. 10.2 - Prob. 2MQCh. 10.2 - Prob. 3MQCh. 10.2 - Prob. 1CRCh. 10.3 - Prob. 1MQCh. 10.3 - In the X174 genome, describe the difference...
Ch. 10.3 - Prob. 3MQCh. 10.3 - Describe how the genome of bacteriophage X174 is...Ch. 10.4 - In what major way does transcription of phage DNA...Ch. 10.4 - Prob. 2MQCh. 10.4 - Why can it be said that transcription of the...Ch. 10.5 - What type of genome is seen in most archaeal...Ch. 10.5 - Compared with other archaeal viruses, what are two...Ch. 10.5 - Prob. 1CRCh. 10.6 - Prob. 1MQCh. 10.6 - Prob. 2MQCh. 10.6 - Prob. 3MQCh. 10.6 - Prob. 1CRCh. 10.7 - Prob. 1MQCh. 10.7 - Prob. 2MQCh. 10.7 - Prob. 3MQCh. 10.7 - Prob. 1CRCh. 10.8 - Prob. 1MQCh. 10.8 - Prob. 2MQCh. 10.8 - How are protein synthesis and genomic replication...Ch. 10.8 - Prob. 1CRCh. 10.9 - Prob. 1MQCh. 10.9 - Prob. 2MQCh. 10.9 - Prob. 3MQCh. 10.9 - Rabies virus and poliovirus both have...Ch. 10.10 - Prob. 1MQCh. 10.10 - Prob. 2MQCh. 10.10 - Prob. 3MQCh. 10.10 - Prob. 1CRCh. 10.11 - Prob. 1MQCh. 10.11 - Prob. 2MQCh. 10.11 - How does the role of reverse transcriptase in the...Ch. 10.11 - Why do both hepadnaviruses and retroviruses...Ch. 10.12 - What type of bacteriophages are most common in the...Ch. 10.12 - Prob. 2MQCh. 10.12 - Prob. 3MQCh. 10.12 - Prob. 1CRCh. 10.13 - Prob. 1MQCh. 10.13 - Prob. 2MQCh. 10.13 - Prob. 3MQCh. 10.13 - Prob. 1CRCh. 10.14 - Prob. 1MQCh. 10.14 - Prob. 2MQCh. 10.14 - Prob. 3MQCh. 10.14 - How do bacterial viruses help prevent human...Ch. 10.15 - If viroids are circular molecules, why are they...Ch. 10.15 - Prob. 2MQCh. 10.15 - Prob. 1CRCh. 10.16 - Prob. 1MQCh. 10.16 - Prob. 2MQCh. 10.16 - Prob. 3MQCh. 10.16 - What are the similarities and differences between...Ch. 10 - Not all proteins are made from the RNA genome of...Ch. 10 - Replication of both strands of DNA in adenoviruses...Ch. 10 - Imagine that you are a researcher at a...Ch. 10 - Prob. 4AQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Inhibiting the reverse transcriptase of HIV is a common method for treating HIV infections. a) The HIV reverse transcriptase has two separate functional domains. One domain has polymerase activity. What type of activity do you think the other domain would have?arrow_forwardThe sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sidearrow_forwardResearchers have been determining the nucleotide sequences of variant forms of SARS-CoV-2, looking for versions of the virus that might be more easily transmitted between humans or that might be more deadly. (a) For example, one mutation in a viral gene changed a GAU codon to a GGU codon. How does this change affect the sequence of the polypeptide encoded by that gene? (b) In another variant form of the virus, a gene is missing six consecutive nucleotides. How would this change affect the sequence of the polypeptide encoded by that gene? (c) In another coronavirus variant, the spike protein (the prominent protein on the surface of the virus) contains a histidine residue where an aspartate (aspartic acid) residue should be. Describe a point mutation in the coronavirus genome that could have caused this change in the spike protein.arrow_forward
- If the sequence 5′-AACGC-3′ were damaged by reactive oxygen species, what would be the most prevalent product, and what would be the result of replication? (Note: show both strands after replication)arrow_forwardExplain the following statement : a) initiation of bacteriall DNA replication is an energy requiring process b) bacterial DNA polymerase can enter the termination sequence but cannot exisarrow_forwardDescribe how each of the following bacteriophages M13, G4 and X174 initate replication.arrow_forward
- Natural selection on the molecular level has produced ribozymes capable of self-replication in the laboratory. How does this occur?arrow_forwardA gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arq- tyr. A mutation in this gene has a G inserted after the second C in the strand. How will this mutation affect the phenotype? A)This will affect the phenotype because although most of the protein will be identical, the first amino acid will be different. B)This will not affect the phenotype because only the second amino acid is different from the original protein. C)This will not affect the phenotype because the protein will be identical to the original protein. D)This will affect the phenotype because all of the amino acids after the first one will be different from the original protein.arrow_forward2) Replicating structures in DNA can be observed in the electron microscope. Regions being replicated appear as bubbles. a) How many replication forks are present? b) Assuming bidirectional replication, how many origins of replication are active in this DNA molecule? c) Assuming that all replication forks move at the same speed, which origin of replication was activated first (left, middle or right)? Why?arrow_forward
- Deamination of adenine results in the formation of hypoxanthine. Hypoxanthine selectively base pairs with cytosine. If this error is not corrected, what base pair can the original A·T base pair be converted to after cycles of DNA replication?a) G·C b) C·G c) T·A d) A·Garrow_forwardAnswer the following questions: 1. Which sequence has a purine base at the 3' end? A) TCTAG B) AUCCT C) GUGCCU D) CCTTC 2. Select a choice that does not describe a lagging strand: A) Has a polynucleotide product in a 5' to 3' direction B) Being produced away from the replication fork C) Complementary strand based on a template strand in 5' and 3' direction D) Composed of multiple RNA primers 3. Which of the following is not observed during elongation process in DNA replication? A) Helicase B) DNA Pol C) Primase D) Okazaki fragmentsarrow_forwardIt was discovered that COVID19 RNA is a sense (+) strand. If the RNA sequence that codes for the 5 viral genes begins with 5’ GGGUACAUGGUAGCC …. 3’, the starting amino sequence is a) N-terminal Gly-Tyr-Met-Val-Ala- C-terminal b) N-terminal Pro-Met-Tyr-His-Arg- C-terminal c) N-terminal Val-Ala- C-terminal d) N-terminal Tyr-His-Arg- C-terminal e) N-terminal Met-Tyr-His-Arg- C-terminalarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY