Starting Out With C++ From Control Structures To Objects Plus Mylab Programming With Pearson Etext -- Access Card Package (8th Edition)
8th Edition
ISBN: 9780133796339
Author: Tony Gaddis
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 10, Problem 2PC
Program Plan Intro
Backward String
- Include the required header files to the program.
- Define function prototype which is used in the program.
- Define the “main()” function.
- Declare the required variables.
- Get the input string from the user and call the function “backward_string”.
- Define the “backward_string” function.
- Declare the variables.
- The “while” loop is used to reverse the given string.
- Finally display the result.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
4. Complete the function show_upper. This function takes one parameter - a string (s). It should return a string made up of all the upper-case characters in s. For example, if s is “aBdDEfgHijK” then show_upper should return “BDEHK”. It should return the upper-case string - not print it. Do not change anything outside show_upper.
IN C Programming Language...THANKS
Write a function that replaces a given string with ‘*’ within a given text if that string is a full word, or the beginning or end of a word. Test your function with a suitable main.
String Manipulation
In this question, you will be implementing the following functions
int findChar(char * str, char c);
Searches for the character c in the string str and returns the index of the character in the string. If the character does not exist, returns -1
int replaceChar(char * str, char c1, char c2);
Searches for the character c1 in the string str and if found, replace it with c2.The function returns the number of replacements it has performed. If the character does not exist, returns 0.
int removeChar(char * str1, char * str2, char c);
Creates a copy of str1 into str2 except for the character c that should be replaced with ‘*’
For example, if
str1=”Hello World” and
c=’l’ then the function should make
str2=”He**o Wor*d”
int isPalindrome(char * str)
Checks to see if a string is Palindrome(reversible). If it is, returns 1, otherwise returns 0. A palindrome string reads similarly from left to right and from right to left like madam, level, radar, etc.
int reverseString(char…
Chapter 10 Solutions
Starting Out With C++ From Control Structures To Objects Plus Mylab Programming With Pearson Etext -- Access Card Package (8th Edition)
Ch. 10.2 - Write a short description of each of the following...Ch. 10.2 - Prob. 10.2CPCh. 10.2 - Write an if statement that will display the word...Ch. 10.2 - What is the output of the following statement?...Ch. 10.2 - Write a loop that asks the user Do you want to...Ch. 10.4 - Write a short description of each of the following...Ch. 10.4 - Prob. 10.7CPCh. 10.4 - Prob. 10.8CPCh. 10.4 - Prob. 10.9CPCh. 10.4 - When complete, the following program skeleton will...
Ch. 10.5 - Write a short description of each of the following...Ch. 10.5 - Write a statement that will convert the string 10...Ch. 10.5 - Prob. 10.13CPCh. 10.5 - Write a statement that will convert the string...Ch. 10.5 - Prob. 10.15CPCh. 10.6 - Prob. 10.16CPCh. 10 - Prob. 1RQECh. 10 - Prob. 2RQECh. 10 - Prob. 3RQECh. 10 - Prob. 4RQECh. 10 - Prob. 5RQECh. 10 - Prob. 6RQECh. 10 - Prob. 7RQECh. 10 - Prob. 8RQECh. 10 - Prob. 9RQECh. 10 - Prob. 10RQECh. 10 - The __________ function returns true if the...Ch. 10 - Prob. 12RQECh. 10 - Prob. 13RQECh. 10 - The __________ function returns the lowercase...Ch. 10 - The _________ file must be included in a program...Ch. 10 - Prob. 16RQECh. 10 - Prob. 17RQECh. 10 - Prob. 18RQECh. 10 - Prob. 19RQECh. 10 - Prob. 20RQECh. 10 - Prob. 21RQECh. 10 - Prob. 22RQECh. 10 - Prob. 23RQECh. 10 - Prob. 24RQECh. 10 - The ________ function returns the value of a...Ch. 10 - Prob. 26RQECh. 10 - The following if statement determines whether...Ch. 10 - Assume input is a char array holding a C-string....Ch. 10 - Look at the following array definition: char...Ch. 10 - Prob. 30RQECh. 10 - Write a function that accepts a pointer to a...Ch. 10 - Prob. 32RQECh. 10 - Prob. 33RQECh. 10 - T F If touppers argument is already uppercase, it...Ch. 10 - T F If tolowers argument is already lowercase, it...Ch. 10 - T F The strlen function returns the size of the...Ch. 10 - Prob. 37RQECh. 10 - T F C-string-handling functions accept as...Ch. 10 - T F The strcat function checks to make sure the...Ch. 10 - Prob. 40RQECh. 10 - T F The strcpy function performs no bounds...Ch. 10 - T F There is no difference between 847 and 847.Ch. 10 - Prob. 43RQECh. 10 - char numeric[5]; int x = 123; numeri c = atoi(x);Ch. 10 - char string1[] = "Billy"; char string2[] = " Bob...Ch. 10 - Prob. 46RQECh. 10 - Prob. 1PCCh. 10 - Prob. 2PCCh. 10 - Prob. 3PCCh. 10 - Average Number of Letters Modify the program you...Ch. 10 - Prob. 5PCCh. 10 - Prob. 6PCCh. 10 - Name Arranger Write a program that asks for the...Ch. 10 - Prob. 8PCCh. 10 - Prob. 9PCCh. 10 - Prob. 10PCCh. 10 - Prob. 11PCCh. 10 - Password Verifier Imagine you are developing a...Ch. 10 - Prob. 13PCCh. 10 - Word Separator Write a program that accepts as...Ch. 10 - Character Analysis If you have downloaded this...Ch. 10 - Prob. 16PCCh. 10 - Prob. 18PCCh. 10 - Check Writer Write a program that displays a...
Knowledge Booster
Similar questions
- Create a function called reverse() that has a string parameter. The function reverses the characters of the string locally. ( in C language)arrow_forwardComputer Science ****Please Write a program CODE in C 2. Write a function which takes a string of any length and returns the number of times the letter a appears in the string. Write the main program, which prompts the user to enter a sentence (up to 100 characters) and uses the function to find the number of times a occurs in the sentence. Print the result.arrow_forward(C++) 9. True/False: the strcpy() function will make sure there is enough memory allocated in the destination string before copying C-strings 10. True/False: when creating a string object, you must dynamically allocate enough bytes to hold the string 11. Consider the following statement, assuming goAgain is a valid char. Rewrite it using toupper() or tolower() if (goAgain == 'y' || goAgain == 'Y') 12. Write a C++ function which accepts a pointer to a C-string as its argument. It should return the number of words in the C-string. For example, for the C-string “The Giants won the pennant!” your function should return 5. You may assume the parameter passed is a pointer to a valid, null-terminated C-string with no newlines or tabs, exactly one space separates each word, and there is at least one word. int wordCounter(char* str)arrow_forward
- C++ Code: DNA Sequence The main() function is already written for you. You will implement the function int numOccurrences(string& STR, string& sequence). Without even understanding what functions do in C++, all you need to know, at this point, is that you have access to the string STR of which you have to find the length of the largest consecutive occurrence in the string sequence. For example, if input sequence is: AGACGGGTTACCATGACTATCTATCTATCTATCTATCTATCTATCTATCACGTACGTACGTATCGAGATAGATAGATAGATAGATCCTCGACTTCGATCGCAATGAATGCCAATAGACAAAA then numOccurrences("AGAT", sequence) should return 5 numOccurrences("TATC", sequence) should return 8 if input sequence is: AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG then numOccurrences("AATG", sequence) should return 7 numOccurrences("TATC", sequence) should return 4 if input sequence is:…arrow_forwardQuestion Mo Write a function that accepts a pointer to a C-string as its argument. The function should count the number of times the character ‘G’ or the character ‘H’ occurs in the argument and return that number. Full explain this question and text typing work only We should answer our question within 2 hours takes more time then we will reduce Rating Dont ignore this linearrow_forwardExercise 1: Word Separator Write a program that accepts as input a sentence in which all of the words are run together, but the first character of each word is uppercase. Convert the sentence to a string in which the words are separated by spaces and only the first word starts with an uppercase letter. For example the string StopAndSmellTheRoses. would be converted to “Stop and smell the roses.” Exercise 2: replaceSubstring Function Write a function named replaceSubstring. The function should accept three string object arguments. Let’s call them string1, string2, and string3. It should search string1 for all occurrences of string2. When it finds an occurrence of string2, it should replace it with string3. For example, suppose the three arguments have the following values: string1: “the dog jumped over the fence” string2: “the” string3: “that” With these three arguments, the function would return a string object with the value “that dog jumped over that fence.” Demonstrate the…arrow_forward
- //the language is c++ Implement function to tokenize a string. std::vector<std::string> tokenize(std::string& line) { } int main(){ std::string ts = "This is a string with no commas semicolons or fullstops"; std::vector<std::string> tok = tokenize(ts); for (auto x : tok) { std::cout<<x<<std::endl; } return 0; }arrow_forwardPython language. Write a function that return multiple value of string type. You have to print those in main function. Hint : - you can use dictionaryarrow_forwardC++ Write an expression to access the last character of a string class object str (not C-string)arrow_forward
- In C++, Write a function that receives a string of characters and return true if the string is in language, otherwise it returns false. You may use following function header (Assume a string is in language if it is read from the left side is the same as it is read from the right side. For example, a-b-d-c is not in the language, a-b-c-a-c-b-a is in language): bool isInLanguage_2(string aString) And I also, want to know if my if statement is incorrect, and if it is how is it incorrect?arrow_forwardPlease Help C++ Write a function that returns an integer and accepts a pointer to a C-string as an argument. The function should count the number of characters in the string and return that number. Demonstrate the function in a simple program that asks the user to input a string, passes it to the function, and then displays the function’s return value.arrow_forwardpython3 program : Write a function that removes all spaces from a given string string and returns the new string.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- C++ Programming: From Problem Analysis to Program...Computer ScienceISBN:9781337102087Author:D. S. MalikPublisher:Cengage Learning
C++ Programming: From Problem Analysis to Program...
Computer Science
ISBN:9781337102087
Author:D. S. Malik
Publisher:Cengage Learning