Starting Out With C++ From Control Structures To Objects Plus Mylab Programming With Pearson Etext -- Access Card Package (8th Edition)
8th Edition
ISBN: 9780133796339
Author: Tony Gaddis
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 10, Problem 10PC
Program Plan Intro
“replaceSubstring” Function
Program plan:
- Include the required header files to the program.
- Declare function prototype which is used in the program.
- Define the “main()” function.
- Declare the required variables.
- Get the input strings from the user and call the function “repalceSubstring” with the input strings.
- Print the result.
- Define the “repalceSubstring” function.
- Check the second and third strings, if both the strings are equal return null.
- Find the first occurrence of the second string in the first string and store in the variable.
- Replace that word with the third string.
- Find the next occurrence of the string and replace.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
String Manipulation
In this question, you will be implementing the following functions
int findChar(char * str, char c);
Searches for the character c in the string str and returns the index of the character in the string. If the character does not exist, returns -1
int replaceChar(char * str, char c1, char c2);
Searches for the character c1 in the string str and if found, replace it with c2.The function returns the number of replacements it has performed. If the character does not exist, returns 0.
int removeChar(char * str1, char * str2, char c);
Creates a copy of str1 into str2 except for the character c that should be replaced with ‘*’
For example, if
str1=”Hello World” and
c=’l’ then the function should make
str2=”He**o Wor*d”
int isPalindrome(char * str)
Checks to see if a string is Palindrome(reversible). If it is, returns 1, otherwise returns 0. A palindrome string reads similarly from left to right and from right to left like madam, level, radar, etc.
int reverseString(char…
Write a function findLetter based on the following rules:
It takes a string named str and a character named ch as parameter, returns the index of the first occurrence of the character ch if the str string contains the character ch; If the relevant character is not found in the string, write a function that returns -1. Call the function inside the main function and test it. You should use the prototype given below:
int findLetter (char str [], char ch)
Question Mo
Write a function that accepts a pointer to a C-string as its argument. The function should count the number of times the character ‘G’ or the character ‘H’ occurs in the argument and return that number.
Full explain this question and text typing work only We should answer our question within 2 hours takes more time then we will reduce Rating Dont ignore this line
Chapter 10 Solutions
Starting Out With C++ From Control Structures To Objects Plus Mylab Programming With Pearson Etext -- Access Card Package (8th Edition)
Ch. 10.2 - Write a short description of each of the following...Ch. 10.2 - Prob. 10.2CPCh. 10.2 - Write an if statement that will display the word...Ch. 10.2 - What is the output of the following statement?...Ch. 10.2 - Write a loop that asks the user Do you want to...Ch. 10.4 - Write a short description of each of the following...Ch. 10.4 - Prob. 10.7CPCh. 10.4 - Prob. 10.8CPCh. 10.4 - Prob. 10.9CPCh. 10.4 - When complete, the following program skeleton will...
Ch. 10.5 - Write a short description of each of the following...Ch. 10.5 - Write a statement that will convert the string 10...Ch. 10.5 - Prob. 10.13CPCh. 10.5 - Write a statement that will convert the string...Ch. 10.5 - Prob. 10.15CPCh. 10.6 - Prob. 10.16CPCh. 10 - Prob. 1RQECh. 10 - Prob. 2RQECh. 10 - Prob. 3RQECh. 10 - Prob. 4RQECh. 10 - Prob. 5RQECh. 10 - Prob. 6RQECh. 10 - Prob. 7RQECh. 10 - Prob. 8RQECh. 10 - Prob. 9RQECh. 10 - Prob. 10RQECh. 10 - The __________ function returns true if the...Ch. 10 - Prob. 12RQECh. 10 - Prob. 13RQECh. 10 - The __________ function returns the lowercase...Ch. 10 - The _________ file must be included in a program...Ch. 10 - Prob. 16RQECh. 10 - Prob. 17RQECh. 10 - Prob. 18RQECh. 10 - Prob. 19RQECh. 10 - Prob. 20RQECh. 10 - Prob. 21RQECh. 10 - Prob. 22RQECh. 10 - Prob. 23RQECh. 10 - Prob. 24RQECh. 10 - The ________ function returns the value of a...Ch. 10 - Prob. 26RQECh. 10 - The following if statement determines whether...Ch. 10 - Assume input is a char array holding a C-string....Ch. 10 - Look at the following array definition: char...Ch. 10 - Prob. 30RQECh. 10 - Write a function that accepts a pointer to a...Ch. 10 - Prob. 32RQECh. 10 - Prob. 33RQECh. 10 - T F If touppers argument is already uppercase, it...Ch. 10 - T F If tolowers argument is already lowercase, it...Ch. 10 - T F The strlen function returns the size of the...Ch. 10 - Prob. 37RQECh. 10 - T F C-string-handling functions accept as...Ch. 10 - T F The strcat function checks to make sure the...Ch. 10 - Prob. 40RQECh. 10 - T F The strcpy function performs no bounds...Ch. 10 - T F There is no difference between 847 and 847.Ch. 10 - Prob. 43RQECh. 10 - char numeric[5]; int x = 123; numeri c = atoi(x);Ch. 10 - char string1[] = "Billy"; char string2[] = " Bob...Ch. 10 - Prob. 46RQECh. 10 - Prob. 1PCCh. 10 - Prob. 2PCCh. 10 - Prob. 3PCCh. 10 - Average Number of Letters Modify the program you...Ch. 10 - Prob. 5PCCh. 10 - Prob. 6PCCh. 10 - Name Arranger Write a program that asks for the...Ch. 10 - Prob. 8PCCh. 10 - Prob. 9PCCh. 10 - Prob. 10PCCh. 10 - Prob. 11PCCh. 10 - Password Verifier Imagine you are developing a...Ch. 10 - Prob. 13PCCh. 10 - Word Separator Write a program that accepts as...Ch. 10 - Character Analysis If you have downloaded this...Ch. 10 - Prob. 16PCCh. 10 - Prob. 18PCCh. 10 - Check Writer Write a program that displays a...
Knowledge Booster
Similar questions
- Write a function findLetter based on the following rules: It takes a string named str and a character named ch as parameter, returns the index of the first occurrence of the character ch if the str string contains the character ch; If the relevant character is not found in the string, write a function that returns -1. Call the function inside the main function and test it. You should use the prototype given below:arrow_forwardWrite a function that counts the occurrences of a word in a string. Thefunction should return an integer. Do not assume that just one space separates words and a string can contain punctuation. Write the function sothat it works with either a String argument or a StringBuilder object.arrow_forwardExercise 1: Word Separator Write a program that accepts as input a sentence in which all of the words are run together, but the first character of each word is uppercase. Convert the sentence to a string in which the words are separated by spaces and only the first word starts with an uppercase letter. For example the string StopAndSmellTheRoses. would be converted to “Stop and smell the roses.” Exercise 2: replaceSubstring Function Write a function named replaceSubstring. The function should accept three string object arguments. Let’s call them string1, string2, and string3. It should search string1 for all occurrences of string2. When it finds an occurrence of string2, it should replace it with string3. For example, suppose the three arguments have the following values: string1: “the dog jumped over the fence” string2: “the” string3: “that” With these three arguments, the function would return a string object with the value “that dog jumped over that fence.” Demonstrate the…arrow_forward
- Problem D. Durdle Game Using the function from the previous problem, write a function durdle_game(target) which takes in as an argument a single string that will be the target to guess, and lets the user attempt to guess the target word. Each time the user makes a guess, the function will print out the result of the previous function to tell the user how close they are. If the user guesses correctly, then the game is over. Have the function return the number of guesses that it took the user to get the correct answer. Examples (text in bold is returned, text in red is user input.): >>> durdle_game('trick') Welcome to Durdle! Enter a guess:touch GBBGB Enter a guess:trash GGBBB Enter a guess:truck GGBGG Enter a guess:trick GGGGG Congratulations, you got it in 4 guesses! 4 >>> durdle_game('stoop') Welcome to Durdle! Enter a guess:chart BBBBY Enter a guess:tones YYBBY Enter a guess:togas YYBBY Enter a guess:tofus YYBBY Enter a guess:stock GGGBB…arrow_forwardComplete the check_character() function which has 2 parameters: A string, and a specified index. The function checks the character at the specified index of the string parameter, and returns a string based on the type of character at that location indicating if the character is a letter, digit, whitespace, or unknown character. Ex: The function calls below with the given arguments will return the following strings: check_character('happy birthday', 2) returns "Character 'p' is a letter"check_character('happy birthday', 5) returns "Character ' ' is a white space"check_character('happy birthday 2 you', 15) returns "Character '2' is a digit"check_character('happy birthday!', 14) returns "Character '!' is unknown" use python please def check_character(word, index): # Type your code here. if __name__ == '__main__': print(check_character('happy birthday', 2)) print(check_character('happy birthday', 5)) print(check_character('happy birthday 2 you', 15))…arrow_forwardC++ Code: DNA Sequence The main() function is already written for you. You will implement the function int numOccurrences(string& STR, string& sequence). Without even understanding what functions do in C++, all you need to know, at this point, is that you have access to the string STR of which you have to find the length of the largest consecutive occurrence in the string sequence. For example, if input sequence is: AGACGGGTTACCATGACTATCTATCTATCTATCTATCTATCTATCTATCACGTACGTACGTATCGAGATAGATAGATAGATAGATCCTCGACTTCGATCGCAATGAATGCCAATAGACAAAA then numOccurrences("AGAT", sequence) should return 5 numOccurrences("TATC", sequence) should return 8 if input sequence is: AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG then numOccurrences("AATG", sequence) should return 7 numOccurrences("TATC", sequence) should return 4 if input sequence is:…arrow_forward
- Write a function findFirstUpper() that takes a string as parameter, finds returns the index of the first uppercase letter in the string. If there is no uppercase letter in the string, then the function will return -1.Example: Function call findFirstUpper("best course is CS104!") will return 15 (index of the 'C').Example: Function call findFirstUpper("good morning!") will return -1 CODEE:PYTHONarrow_forward/ Write a function that takes 2 arguments, both strings. // It returns as a number how many times the second string occurs within the first string. const subStringCount = (string, subString) => { } / /Examples subStringCount("mississippi", "i") // returns 4 subStringCount("lions and tigers and bears", "and") // returns 2 Exercise 2 // ---------------------------------------------------------------- // Write a function that takes 3 arguments, all integers. // It returns an array starting with the first number and increasing by the interval until it reaches // the second number, including the second number if it is part of the pattern. // For this exercise you can assume that the first integer is strictly less than the second integer. const countWithIntervals = (start, end, interval) => { } / / Examples countWithIntervals(1, 10, 2) // returns [1, 3, 5, 7, 9] countWithIntervals(5, 20, 3) // returns [5, 8, 11, 14, 17, 20] // Write a function that takes 1 argument, a…arrow_forward21.1 LAB: Fun with characters Complete the check_character() function which has 2 parameters: A string, and a specified index. The function checks the character at the specified index of the string parameter, and returns a string based on the type of character at that location indicating if the character is a letter, digit, whitespace, or unknown character. Ex: The function calls below with the given arguments will return the following strings: check_character('happy birthday', 2) returns "Character 'p' is a letter"check_character('happy birthday', 5) returns "Character ' ' is a white space"check_character('happy birthday 2 you', 15) returns "Character '2' is a digit"check_character('happy birthday!', 14) returns "Character '!' is unknown" Use Python, please.arrow_forward
- Create using the c++ string class. Write a function that counts the occurence of each letter in the string using the following header: void count (const string& s, int counts [], int size) where counts is any array of 26 integers. counts[0], counts [1],...and counts [25] count the occurence of a, b,...and z, respectively. Letters are not case-sensitive, ie, A & a are counted the same as a. Write a test program that reads a string, invokes the count() function, and displays the non-zero counts. Here is a sample run of the program: Enter a string: Welcome to New York! c: 1 times e: 3 times k: 1 times l: 1 times m: 1 times n: 1 times o: 3 times r: 1 times t: 1 times w: 2 times y: 1 timesarrow_forwardCreate a function called reverse() that has a string parameter. The function reverses the characters of the string locally. ( in C language)arrow_forwardExercise 8.4. Define the required function as indicated in the exercise. In the function, iterate over the parameter string s anduse a one-way selection statement and a counting variable to determine the number of occurrences of the parameter c in the string. EX 8.4 (Occurrences of a specified character) Write a function that finds the number of occurrences of a specified character in a string using the following header: def count(s, ch): The str class has the count method. Implement your method without using the count method. For example, count("Welcome", 'e') returns 2. Write a test program that prompts the user to enter a string followed by a character and displays the number of occurrences of the character in the string.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- C++ Programming: From Problem Analysis to Program...Computer ScienceISBN:9781337102087Author:D. S. MalikPublisher:Cengage LearningC++ for Engineers and ScientistsComputer ScienceISBN:9781133187844Author:Bronson, Gary J.Publisher:Course Technology Ptr
C++ Programming: From Problem Analysis to Program...
Computer Science
ISBN:9781337102087
Author:D. S. Malik
Publisher:Cengage Learning
C++ for Engineers and Scientists
Computer Science
ISBN:9781133187844
Author:Bronson, Gary J.
Publisher:Course Technology Ptr