STARTING OUT WITH C++FROM CONTROL STRU
18th Edition
ISBN: 9781323815458
Author: GADDIS
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 10, Problem 5PC
Program Plan Intro
Sentence Capitalizer
Program plan:
- Include the required header files to the program.
- Define function prototype which is used in the program.
- Define the “main()” function.
- Declare the required variables.
- Get the input c-string from the user and call the function “capital”.
- Print the c-string result.
- Get the input string object from the user and call the function “capital”.
- Print the string object result.
- Define the “capital” function.
- Declare the variable.
- The “while” loop is used to capitalize the first letters.
- The “while” loop condition is used to ignore the whitespace.
- The “if” condition is used to capitalize the first letters.
- The “while” loop is used to ignore the non-null and non-period character.
- The “if” condition is used to move to the next string.
- Define the “capital” function.
- The “if” condition change the first letter into uppercase letter.
- The “for” loop is used to capitalize the first letters.
- The “if” condition is used to ignore the whitespaces and capitalize the first letters.
- Finally return the result to the main function.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
String Manipulation
In this question, you will be implementing the following functions
int findChar(char * str, char c);
Searches for the character c in the string str and returns the index of the character in the string. If the character does not exist, returns -1
int replaceChar(char * str, char c1, char c2);
Searches for the character c1 in the string str and if found, replace it with c2.The function returns the number of replacements it has performed. If the character does not exist, returns 0.
int removeChar(char * str1, char * str2, char c);
Creates a copy of str1 into str2 except for the character c that should be replaced with ‘*’
For example, if
str1=”Hello World” and
c=’l’ then the function should make
str2=”He**o Wor*d”
int isPalindrome(char * str)
Checks to see if a string is Palindrome(reversible). If it is, returns 1, otherwise returns 0. A palindrome string reads similarly from left to right and from right to left like madam, level, radar, etc.
int reverseString(char…
IN C Programming Language...THANKS
Write a function that replaces a given string with ‘*’ within a given text if that string is a full word, or the beginning or end of a word. Test your function with a suitable main.
4. Complete the function show_upper. This function takes one parameter - a string (s). It should return a string made up of all the upper-case characters in s. For example, if s is “aBdDEfgHijK” then show_upper should return “BDEHK”. It should return the upper-case string - not print it. Do not change anything outside show_upper.
Chapter 10 Solutions
STARTING OUT WITH C++FROM CONTROL STRU
Ch. 10.2 - Write a short description of each of the following...Ch. 10.2 - Prob. 10.2CPCh. 10.2 - Write an if statement that will display the word...Ch. 10.2 - What is the output of the following statement?...Ch. 10.2 - Write a loop that asks the user Do you want to...Ch. 10.4 - Write a short description of each of the following...Ch. 10.4 - Prob. 10.7CPCh. 10.4 - Prob. 10.8CPCh. 10.4 - Prob. 10.9CPCh. 10.4 - When complete, the following program skeleton will...
Ch. 10.5 - Write a short description of each of the following...Ch. 10.5 - Write a statement that will convert the string 10...Ch. 10.5 - Prob. 10.13CPCh. 10.5 - Write a statement that will convert the string...Ch. 10.5 - Write a statement that will convert the integer...Ch. 10.6 - Prob. 10.16CPCh. 10 - Prob. 1RQECh. 10 - Prob. 2RQECh. 10 - Prob. 3RQECh. 10 - Prob. 4RQECh. 10 - Prob. 5RQECh. 10 - Prob. 6RQECh. 10 - Prob. 7RQECh. 10 - Prob. 8RQECh. 10 - Prob. 9RQECh. 10 - Prob. 10RQECh. 10 - The __________ function returns true if the...Ch. 10 - Prob. 12RQECh. 10 - Prob. 13RQECh. 10 - The __________ function returns the lowercase...Ch. 10 - The _________ file must be included in a program...Ch. 10 - Prob. 16RQECh. 10 - Prob. 17RQECh. 10 - Prob. 18RQECh. 10 - Prob. 19RQECh. 10 - Prob. 20RQECh. 10 - Prob. 21RQECh. 10 - Prob. 22RQECh. 10 - Prob. 23RQECh. 10 - Prob. 24RQECh. 10 - The ________ function returns the value of a...Ch. 10 - Prob. 26RQECh. 10 - The following if statement determines whether...Ch. 10 - Assume input is a char array holding a C-string....Ch. 10 - Look at the following array definition: char...Ch. 10 - Prob. 30RQECh. 10 - Write a function that accepts a pointer to a...Ch. 10 - Prob. 32RQECh. 10 - Prob. 33RQECh. 10 - T F If touppers argument is already uppercase, it...Ch. 10 - T F If tolowers argument is already lowercase, it...Ch. 10 - T F The strlen function returns the size of the...Ch. 10 - Prob. 37RQECh. 10 - T F C-string-handling functions accept as...Ch. 10 - T F The strcat function checks to make sure the...Ch. 10 - Prob. 40RQECh. 10 - T F The strcpy function performs no bounds...Ch. 10 - T F There is no difference between 847 and 847.Ch. 10 - Prob. 43RQECh. 10 - char numeric[5]; int x = 123; numeri c = atoi(x);Ch. 10 - char string1[] = "Billy"; char string2[] = " Bob...Ch. 10 - Prob. 46RQECh. 10 - Prob. 1PCCh. 10 - Prob. 2PCCh. 10 - Prob. 3PCCh. 10 - Average Number of Letters Modify the program you...Ch. 10 - Prob. 5PCCh. 10 - Prob. 6PCCh. 10 - Name Arranger Write a program that asks for the...Ch. 10 - Prob. 8PCCh. 10 - Prob. 9PCCh. 10 - Prob. 10PCCh. 10 - Prob. 11PCCh. 10 - Password Verifier Imagine you are developing a...Ch. 10 - Prob. 13PCCh. 10 - Word Separator Write a program that accepts as...Ch. 10 - Character Analysis If you have downloaded this...Ch. 10 - Prob. 16PCCh. 10 - Prob. 17PCCh. 10 - Prob. 18PCCh. 10 - Check Writer Write a program that displays a...
Knowledge Booster
Similar questions
- Computer Science ****Please Write a program CODE in C 2. Write a function which takes a string of any length and returns the number of times the letter a appears in the string. Write the main program, which prompts the user to enter a sentence (up to 100 characters) and uses the function to find the number of times a occurs in the sentence. Print the result.arrow_forwardComplete the check_character() function which has 2 parameters: A string, and a specified index. The function checks the character at the specified index of the string parameter, and returns a string based on the type of character at that location indicating if the character is a letter, digit, whitespace, or unknown character. Ex: The function calls below with the given arguments will return the following strings: check_character('happy birthday', 2) returns "Character 'p' is a letter"check_character('happy birthday', 5) returns "Character ' ' is a white space"check_character('happy birthday 2 you', 15) returns "Character '2' is a digit"check_character('happy birthday!', 14) returns "Character '!' is unknown" use python please def check_character(word, index): # Type your code here. if __name__ == '__main__': print(check_character('happy birthday', 2)) print(check_character('happy birthday', 5)) print(check_character('happy birthday 2 you', 15))…arrow_forwardWrite a C++ program using C-Strings 4. This function returns the index in string s where the substring can first be found. For example if s is “Skyscraper” and substring is “ysc” the function would return 2. It should return -1 if the substring does not appear in the string. int findSubstring(char *s, char substring[]) 5. This function returns true if the argument string is a palindrome. It returns false if it is not. A palindrome is a string that is spelled the same as its reverse. For example “abba” is a palindrome. So is “hannah”, “abc cba”, and “radar”. bool isPalindrome(char *s) Note: do not get confused by white space characters. They should not get any special treatment. “abc ba” is not a palindrome. It is not identical to its reverse. 6) This function should reverse the words in a string. A word can be considered to be any characters, including punctuation, separated by spaces (only spaces, not tabs, \n etc.). So, for example, if s is “The Giants won the Pennant!”…arrow_forward
- C++ Code: DNA Sequence The main() function is already written for you. You will implement the function int numOccurrences(string& STR, string& sequence). Without even understanding what functions do in C++, all you need to know, at this point, is that you have access to the string STR of which you have to find the length of the largest consecutive occurrence in the string sequence. For example, if input sequence is: AGACGGGTTACCATGACTATCTATCTATCTATCTATCTATCTATCTATCACGTACGTACGTATCGAGATAGATAGATAGATAGATCCTCGACTTCGATCGCAATGAATGCCAATAGACAAAA then numOccurrences("AGAT", sequence) should return 5 numOccurrences("TATC", sequence) should return 8 if input sequence is: AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG then numOccurrences("AATG", sequence) should return 7 numOccurrences("TATC", sequence) should return 4 if input sequence is:…arrow_forward10.17: Morse Code Converter C++Morse code is a code where each letter of the English alphabet, each digit, and various punctuation characters are represented by a series of dots and dashes. Table 10-8 from the textbook shows part of the code. Write a program that asks the user to enter a string, and then converts that string to Morse code. Note that Morse code represents both upper and lower case letters so that both 'A' and 'a' will be converted to ".-". Input Validation.None. Instructor Notes: Note: You can use the Morse table in the book or this site (space isn't listed, but it is just mapped to a space). You will most certainly need to create two parallel arrays to map the characters to the Morse code strings.arrow_forwardWord Separator Write a program that accepts as input a sentence in which all of the words are run together but the first character of each word is uppercase. Convert the sentence to a string in which the words are separated by spaces and only the first word starts with an uppercase letter. For example the string “StopAndSmellTheRoses.” would be converted to “Stop and smell the roses.” LINUX !#/bin/basharrow_forward
- (String Matching): Write a program to use Horspool’s Algorithm to find the pattern in the string. You can define two variables called Text and Pattern. Please display shift table for that pattern and display the shift value for each step. If not match, display a message “Unsuccessful Search”. If match, display the index. For example, If Text =“BARD LOVED BANANAS” and Pattern=”BAOBAB”. The result will be: Shift Table: A=1, B=2, O=3, other=6 Shift 6, shift 2, shift 6, pattern not found If Text=”BARD LOVED BABAOBABANAS” and Pattern=”BAOBAB”. The result will be: Shift Table: A=1, B=2, O=3, other=6 Shift 6, shift 2, shift 2, shift 3, pattern found at position 13 Please let me know the solution in Java which gives exact mentioned outputs in questionarrow_forward(String Matching): Write a program to use Horspool’s Algorithm to find the pattern in the string. You can define two variables called Text and Pattern. Please display shift table for that pattern and display the shift value for each step. If not match, display a message “Unsuccessful Search”. If match, display the index. For example, If Text =“BARD LOVED BANANAS” and Pattern=”BAOBAB”. The result will be: Shift Table: A=1, B=2, O=3, other=6 Shift 6, shift 2, shift 6, pattern not found If Text=”BARD LOVED BABAOBABANAS” and Pattern=”BAOBAB”. The result will be: Shift Table: A=1, B=2, O=3, other=6 Shift 6, shift 2, shift 2, shift 3, pattern found at position 13 Please let me know the solution which gives exact mentioned outputs in questionarrow_forwardC++ Write an expression to access the last character of a string class object str (not C-string)arrow_forward
- Homework 10-1 Programming Challenge: 2 - Backwards String Write a function that accepts a string and returns a string in which the contents are the reverse of the original string, and a program in which this function is demonstrated. The prototype is string reverseString(const string &); This might need a little explanation. We want to pass the string by reference (as is customary for objects) but we don't want the function to make any changes to our string. Thus, we pass as a "constant reference." Newer languages like Java do this automatically; if you pass an object to a Java method, it's handled internally kind of like this, as a constant reference to that object. Any changes made to the object within the function are strictly local; the original object is unchanged. So our function will return a brand new string with contents equal to the reverse of the string sent to the function.arrow_forwardIn C++, Write a function that receives a string of characters and return true if the string is in language, otherwise it returns false. You may use following function header (Assume a string is in language if it is read from the left side is the same as it is read from the right side. For example, a-b-d-c is not in the language, a-b-c-a-c-b-a is in language): bool isInLanguage_2(string aString) And I also, want to know if my if statement is incorrect, and if it is how is it incorrect?arrow_forwardc++ A palindrome is a string that reads the same both forward and backward. For example, the string "madam" is a palindrome. Write a program that uses a recursive function to check whether a string is a palindrome. Your program must contain a value-returning recursive function that returns true if the string is a palindrome and false otherwise. Do not use any global variables; use the appropriate parameter.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Database System ConceptsComputer ScienceISBN:9780078022159Author:Abraham Silberschatz Professor, Henry F. Korth, S. SudarshanPublisher:McGraw-Hill EducationStarting Out with Python (4th Edition)Computer ScienceISBN:9780134444321Author:Tony GaddisPublisher:PEARSONDigital Fundamentals (11th Edition)Computer ScienceISBN:9780132737968Author:Thomas L. FloydPublisher:PEARSON
- C How to Program (8th Edition)Computer ScienceISBN:9780133976892Author:Paul J. Deitel, Harvey DeitelPublisher:PEARSONDatabase Systems: Design, Implementation, & Manag...Computer ScienceISBN:9781337627900Author:Carlos Coronel, Steven MorrisPublisher:Cengage LearningProgrammable Logic ControllersComputer ScienceISBN:9780073373843Author:Frank D. PetruzellaPublisher:McGraw-Hill Education
Database System Concepts
Computer Science
ISBN:9780078022159
Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan
Publisher:McGraw-Hill Education
Starting Out with Python (4th Edition)
Computer Science
ISBN:9780134444321
Author:Tony Gaddis
Publisher:PEARSON
Digital Fundamentals (11th Edition)
Computer Science
ISBN:9780132737968
Author:Thomas L. Floyd
Publisher:PEARSON
C How to Program (8th Edition)
Computer Science
ISBN:9780133976892
Author:Paul J. Deitel, Harvey Deitel
Publisher:PEARSON
Database Systems: Design, Implementation, & Manag...
Computer Science
ISBN:9781337627900
Author:Carlos Coronel, Steven Morris
Publisher:Cengage Learning
Programmable Logic Controllers
Computer Science
ISBN:9780073373843
Author:Frank D. Petruzella
Publisher:McGraw-Hill Education