EBK ESSENTIALS OF GENETICS
9th Edition
ISBN: 8220102741614
Author: Palladino
Publisher: YUZU
expand_more
expand_more
format_list_bulleted
Question
Chapter 10, Problem 6PDQ
Summary Introduction
To review:
Predicting correct DNA (deoxyribonucleic acid) replication model by analyzing a genetic model of an unknown creature.
Introduction:
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Approximately how many high-energy bonds does DNA polymerase use to replicate a bacterial chromosome (ignoring helicase and other enzymes associated with the replication fork)? compared with its own dry weight of 10–12 g, how much glucose does a single bacterium need to provide enough energy to copy its DNA once?
The chromosome of E. coli contains 4.6 million bp. How long will it take to replicate its DNA? Assuming that DNA polymerase III is the primary enzyme involved and that it can actively proofread during DNA synthesis, how many base pair mistakes will be made in one round of DNA replication in a bacterial population containing 1000 bacteria?
a) "Out of three E.coli DNA polymerases, DNA polymerases 3 has a high processivity and rate of polymerization and therefore better suited for replication of the genome" What is meant by processivity? how does the DNA polymerase 3 maintain high processivity?
b) What is a replication fork ?. Give the protein/enzymes of a replication fork and describe their function?
Chapter 10 Solutions
EBK ESSENTIALS OF GENETICS
Ch. 10 -
CASE STUDY | At loose ends
A researcher was...Ch. 10 - Prob. 2CSCh. 10 - Prob. 3CSCh. 10 - Prob. 4CSCh. 10 - HOW DO WE KNOW? In this chapter, we focused on how...Ch. 10 - Review the Chapter Concepts list on p. 180. These...Ch. 10 - Compare conservative, semiconservative, and...Ch. 10 - Prob. 4PDQCh. 10 - Predict the results of the experiment by Taylor,...Ch. 10 - Prob. 6PDQ
Ch. 10 - Prob. 7PDQCh. 10 - Prob. 8PDQCh. 10 - Prob. 9PDQCh. 10 - Prob. 10PDQCh. 10 - Prob. 11PDQCh. 10 - Prob. 12PDQCh. 10 - Prob. 13PDQCh. 10 -
14. Distinguish between (a) unidirectional and...Ch. 10 - Prob. 15PDQCh. 10 - Define and indicate the significance of (a)...Ch. 10 - Outline the current model for DNA synthesis.Ch. 10 - Why is DNA synthesis expected to be more complex...Ch. 10 - Prob. 19PDQCh. 10 - Several temperature-sensitive mutant strains of E....Ch. 10 - Prob. 21PDQCh. 10 - Prob. 22PDQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Questions are talking about amplification of DNA When we run the gel, we also run a ladder why? what information does that give us. why does it form a ladder shape on the gel (what is happening to cause things to separate out in many bands)?arrow_forwardTrue or False: 1. There is a reduction in the length of the DNA after every round of replication. 2. When transcribing, growing transcripts always run towards the 5’end of the template strand.arrow_forwardDraw a molecule of DNA undergoing eukaryotic linear replication. On your drawing, identify (a) origin of replication, (b) polarity (5′ and 3′ ends) of all template and newly synthesized strands, (c) leading and lagging strands, (d) Okazaki fragments, and (e) locations of primers.arrow_forward
- 1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocityarrow_forwardIn bacterial transformation ... 1, Why do you have to incubate the competent bacterial cells on ice after the addition of plasmid DNA? 2. Why do you have to add SOC (Super Optimal Broth with Catabolite repression) medium to bacterial cells? 3. Why do you have to incubate the bacterial cells in SOC medium at 37oC for 45 minutes?arrow_forwardDuring agarose gel electrophoresis, why does DNA move through the gel when electric current is applied? because DNA is negatively charged because a charged chemical from the loading buffer is bound to the DNA because DNA is positively charged because DNA absorbs electricityarrow_forward
- 5' ATTTACGTTTT 3' 3' TAAATGCAAAA 5' Need help drawing a diagram showing the replication fork at the beginning of the ORI that includes the leading strands, lagging strands, snd the Okazaki fragments of the ORI templatearrow_forwardHow do we explain the large expected difference in free energy of binding for high fidelity of DNA replication of ~ 1 in 10^7 errors given the base pairing energetics is not enough to match expected difference in free energy for fidelity of DNA replication?arrow_forwardIn Semi conservative replication: A. After one round of replication of a single molecule of DNA, one DNA molecule will be produced that contains two parental strands of DNA and one DNA molecule will be produced that contains two new (or de novo) strands. B. After one round of replication of a single molecule of DNA, two resulting DNA molecules will be produced both of which contain a mix of both parental and new DNA interspersed on every strand of DNA C. After two rounds of replication of a single molecule of DNA, two resulting DNA molecules will contain both a parental strand and a new strand of DNA and the other two resulting DNA molecules will contain all new (or de novo) DNA D. After two rounds of replication of a single molecule of DNA, one resulting DNA molecule will contain 2 parental strands of DNA and the other three resulting DNA molecules will contain all new (or de novo) DNA E. A and C F. B and Darrow_forward
- 110.Which of the following best explains the leading daughter DNA strand? A.The gaps within the leading strand are sealed by DNA ligase. B.The leading strand is synthesized by the enzyme primase. C.It is polymerized continuously by DNA polymerase from 5' - 3' direction. D. It is polymerized discontinuously by DNA polymerase from 5' - 3' direction which leaves gaps known as Okazaki fragments.arrow_forwardSliding-clamp proteins load polymerase onto the primer and maintain its stable association with the template. true or false? DNA polymerases add a deoxyribonucleotide triphosphate to the 3' hydroxyl group of a growing DNA chain (the primer strand). true or false?arrow_forwardThe proteins and enzymes listed below are all required for DNA replication in E. coli, but they are listed in a random order. Determine the correct order in which they function in replication, by selecting the correct number from the drop-down menu in each case, with 1 being first and 6 being last.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Introduction to the NIOSH Manual of Analytical Methods Fifth edition; Author: Centers for Disease Control and Prevention (CDC);https://www.youtube.com/watch?v=B5rUrKLMoas;License: Standard Youtube License