![EBK CONCEPTS OF GENETICS](https://www.bartleby.com/isbn_cover_images/9780134818979/9780134818979_largeCoverImage.gif)
EBK CONCEPTS OF GENETICS
12th Edition
ISBN: 9780134818979
Author: Killian
Publisher: YUZU
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 11, Problem 24PDQ
In 1994, telomerase activity was discovered in human cancer cell lines. Although telomerase is not active in human somatic tissue, human somatic cells do contain the genes for telomerase proteins and telomerase RNA. Since inappropriate activation of telomerase may contribute to cancer, why do you think the genes coding for this enzyme have been maintained in the human genome throughout evolution? Are there any types of human body cells where telomerase activation would be advantageous or even necessary? Explain.
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Mice that are engineered to block expression of the gene coding for telomerase protein age at a much faster rate than normal and have a decreased life span.
The results of these mice experiments led researchers to propose that treatments that could lead to overexpression of the telomerase gene might serve as the “fountain of youth” leading to reversal of aging in humans. Why should we be very cautious about trying such treatments? Why it might be advantageous for multicellular organisms for most of their somatic cells not to express telomerase?
Different mutations in the WDR62 gene that inactivate gene function were found in the genomes of many different people with microcephaly. This information provided strong support for the idea that the WDR62 gene mutation causes microcephaly.
The human genome sequence identified WDR62 as one of the approximately 27,000 genes in the human genome. What information about the function of WDR62 do you think was learned originally from the DNA sequence of the normal human genome?
What additional information was provided by identification of WDR62 as the microcephaly disease gene?
Many cancer cells are immortal and can be cultured in the laboratory for many years. Many of these cell lines have highly active telomerase activities. Why would that affect the ability of cancer cells to sustain growth and cell division?
Chapter 11 Solutions
EBK CONCEPTS OF GENETICS
Ch. 11 - In the Meselson-Stahl experiment, which of the...Ch. 11 - An alien organism was investigated. When DNA...Ch. 11 - Why might mutations in genes encoding telomerase...Ch. 11 - Although the brother is an immunologically matched...Ch. 11 - Prob. 3CSCh. 11 - HOW DOWE KNOW? In this chapter, we focused on how...Ch. 11 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 11 - Compare conservative, semiconservative, and...Ch. 11 - Describe the role of 15N in the MeselsonStahl...Ch. 11 - Predict the results of the experiment by Taylor,...
Ch. 11 - What are the requirements for in vitro synthesis...Ch. 11 - In Kornbergs initial experiments, it was rumored...Ch. 11 - How did Kornberg assess the fidelity of DNA...Ch. 11 - Which characteristics of DNA polymerase I raised...Ch. 11 - Kornberg showed that nucleotides are added to the...Ch. 11 - What was the significance of the polA1 mutation?Ch. 11 - Summarize and compare the properties of DNA...Ch. 11 - List and describe the function of the ten subunits...Ch. 11 - Distinguish between (a) unidirectional and...Ch. 11 - List the proteins that unwind DNA during in vivo...Ch. 11 - Define and indicate the significance of (a)...Ch. 11 - Outline the current model for DNA synthesis.Ch. 11 - Why is DNA synthesis expected to be more complex...Ch. 11 - Suppose that E. coli synthesizes DNA at a rate of...Ch. 11 - Several temperature-sensitive mutant strains of E....Ch. 11 - While many commonly used antibiotics interfere...Ch. 11 - Describe the end-replication problem in...Ch. 11 - Many of the gene products involved in DNA...Ch. 11 - In 1994, telomerase activity was discovered in...Ch. 11 - The genome of D. melanogaster consists of...Ch. 11 - Prob. 26ESPCh. 11 - DNA polymerases in all organisms add only 5...Ch. 11 - Assume that the sequence of bases shown below is...Ch. 11 - Reiji and Tuneko Okazaki conducted a now classic...Ch. 11 - Consider the drawing of a dinucleotide below. (a)...Ch. 11 - To gauge the fidelity of DNA synthesis, Arthur...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Some bacteria might be able to respond to environmental stress by increasing the rate at which mutations occur during cell division. How might this be accomplished? Do you think there would be an evolutionary advantage of this ability? Explain.arrow_forwardAll the cells of one organism share the same genome. However, during development, some cells develop into skin cells while others develop into muscle cells. Briefly explain how the same genetic instructions can result in two different cell types in the same organism.arrow_forwardWith age, somatic cells are thought to accumulate genomic "scars"as a result of the inaccurate repair of double-strand breaks by non homologous end-joining (NHEJ). Estimates based on the frequency of breaks in primary human fibroblasts suggest that by age 70 each human somatic cell may carry some 2000 NHEJ-induced mutations due to inaccurate repair. If these mutations were distributed randomly around the genome, how many genes would you expect to be affected? Would you expect cell function to be compromised? Why or why not? (Assume that 2% of the genome - 1.5% coding and 0.5% regulatory - is crucial information.)arrow_forward
- It is possible to take the DNA of a gene from any source and place it on a chromosome in the nucleus of a yeast cell. When you take DNA of a human gene and put it into a yeast cell chromosome, the yeast cell can synthesize the human protein. However, when you remove the DNA for a gene normally present on yeast mitochondrial chromosomes and put it on a yeast chromosome in the nucleus, the yeast cell cannot synthesize the correct protein, even though the gene comes from the same organism. Explain. What would you need to do to ensure that such a yeast cell could make the correct protein?arrow_forwardn yeast cells, telomerase remains active and maintains telomeres of about 300 base pairs. Propose what would happen to the telomeres over time in a yeast lineage in which the following mutations were created. The gene encoding the catalytic subunit of the telomerase is deleted.arrow_forwardYou are interested in the effects of mutations on the expression of a human protein- encoding gene expressed in skin cells. The gene has one intron that is 450 nucleotides long. After this intron is removed from the pre-mRNA, the mRNA transcript is 1100 nucleotides in length. Diploid somatic cells have two copies of this gene. Predict the size and amount of mRNA from the cytosol of skin cells, which were obtained from the following individuals: • Individual 1: Normal individual with no mutations in this gene. • Individual 2: Homozygous for a deletion that removes the -10 to -100 region of the gene that encodes this mRNA. • Individual 3: Heterozygous in which one gene is normal and the other gene has a deletion that removes the -10 to -100 region. • Individual 4: Homozygous for a five-nucleotide deletion in the intron that removes the GT sequence at the 5' splice site. Explain your answers.arrow_forward
- expression of recombinant proteins in yeast is an important tool for biotechnology companies that produce new drugs for human use.in an attempt to get a new gene X expressed in yeast, a researcher has integrated gene X into the yeast genome near a telomere. will this strategy result in good expression of gene X? why or why not?arrow_forwardDo a few cells created by therapeutic cloning of your own somatic cells constitute life? If these cells do constitute life, do they have the same rights as a human being conceived naturally? If it were possible, should someone be allowed to grow his or her own therapeutic clone into an adult?arrow_forwardExpression of recombinant proteins in yeast is an important tool for biotechnology companies that produce new drugs for human use. In an attempt to get a new gene X expressed in yeast, a researcher has integrated gene X into the yeast genome near a telomere. Will this strategy result in good expression of gene X? Why or why not? please try to explain a bit elaborately.arrow_forward
- Expression of recombinant proteins in yeast is an important tool for biotechnology companies that produce new drugs for human use. In an attempt to get a new gene X expressed in yeast, a researcher has integrated gene X into the yeast genome near a telomere. Will this strategy result in good expression of gene X? Why or why not? Would the outcome of this experiment differ if the experiment had been performed in a yeast line containing mutations in the H3 or H4 histone tails?arrow_forwardA drug company is trying to develop telomerase inhibitors to treat hepatocellular carcinoma. They test their drugs on the purified telomerase from both humans and mice and find they are very potent inhibitors of enzyme activity. The drugs also inhibit growth of HEPG2 cells which are an immortalized human liver cell line. As a final study before commencing human trials, they test the effect of the drugs on formation of liver tumors in mice treated with a potent hepatocarcinogen. Unfortunately they see no effect of these drugs on development of liver tumors in mice. Explain the fundamental mistake the researchers made in this experiment. What defect might you expect these mice to have if their embryos were treated with these drugs early in development?arrow_forwardBy whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model. You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos? You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA? 5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’ 3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’ After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
What are Mutations and what are the different types of Mutations?; Author: Science ABC;https://www.youtube.com/watch?v=I16YlE8qTBU;License: Standard youtube license