Biochemistry
6th Edition
ISBN: 9781305577206
Author: Reginald H. Garrett, Charles M. Grisham
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 12, Problem 16P
Interpretation Introduction
Interpretation:
The number of organisms whose genome sequences have been completed is to be discovered by searching the given website and exploring the available information from the list.
Concept introduction:
The genetic material of a living thing which contains DNA and RNA is known as genome. It consists of genes, non-coding DNA and the mitochondrial DNA. The human genome consists of a genome possessed by Homo sapiens that is composed of
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionKnowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Preparing cDNA Libraries from Different Cells Describe an experimental protocol for the preparation of to cDNA libraries, one from anaerobically grown yeast cells and the second from aerobically grown yeast cell.arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Deducing DNA Sequence from Sanger Sequencing Results The output of an automated DNA sequence determination by the Sanger dideoxy chain termination method, performed as illustrated in Figure 11.3, is disp1ayed at right. What is the sequence of the original oligonucleotide?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. An Estimation of Minimal Genome Size for a Living Cell Studies of existing cells to determine the minimum number of genes for a living cell have suggested that 206 genes are sufficient. If the ratio of protein-coding genes to non-protein-coding genes is the same in this minimal organism as the genes of Mycoplasma genitulium, how many proteins are represented in these 206 genes. How many base pairs would be required to form the genome of this minimal organism if the genes are the same size as M genilalium genes? (Section 1.5)arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Designing Primers for PCR Amplification of a DNA Sequence Given the following short DNA duplex of sequence (53)ATGCCGTAGTCGATCATTACGATAGCATAGCACAGGGATCCA- CATGCACACACATGACATAGGACAGATAGCAT what oligonucleotide primers (17-mers) would be required for PCR amplification of this duplex?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Calculate the Frequency of Occurrence of an RNAi Target Sequence The RNAs acting in RNAi are about 21 nucleotides long. To judge whether it is possible to uniquely target a particular gene with a RNA of this size, consider The following calculation: What is the expected frequency of occurrence of a specific 21-nucleotide sequence?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. CRISPR/Cas9: Design of a gRNA to Target the Human PVALB Gene The human PVALB gene, which encodes the Ca2+-binding protein parvalbumin, can be Targeted by CRISPR/Cas9, at the protospacer sequence - ATGCAGGAGGGTGGCGAGAGGGGCCGAGAT- followed by a -TGG-PAM trinucleotide. Give the sequence of the spacer region of a gRNA that will target the complementary DNA strand at this site. Include at the 3'-end of your gRNA sequence a region that will form a stem-loop structure with a 5'-AGCAUAGCUGUAAAAC- sequence downstream in the gRNA to create the dsRNA-binding site for Cas9.arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Chargaff’s Rules for the Base Composition of DNA Chargaff’s results (Table 10.1) yielded a molar ratio of 1 1.29 for A to G in ox DNA, 1.43 for T to C, 1.04 for A to T, and 1.00 for G to C. Given these values, what are the approximate mole fractions of A. C, G. and T in ox DNA?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. B- and Z-DNA Supercoiling Parameters Suppose one double helical turn of a superhelical DNA molecule changes conformation from B- to Z-form. What are the changes in L, W, and T? Why do you suppose the transition of DNA from B- to Z-form is favored by negative supercoiling?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Abundance of the Different Bases in the Human Genome Results on the human genome published in Science (Science 291 :1304—1350 [2001]) indicate that the haploid human genome consists of 2.91 gigabase pairs (2.91 X ]09 base pairs} and that 27% of the bases in human DNA are A. Calculate the number of A. T, G, and C residues in a typical human cell.arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Calculating Tms and Separating DNA Molecules That Differ in G:C Content At 0.2 M Na+, the melting temperature of double-stranded DNA is given by the formula, Tm = 69.3 + 0 41 (% G + C). The DNAs from mice and rats have (G + C) contents of 44% and 40%, respectively. Calculate the Tms for these DNAs in 0.2 M NaCl. If samples of these DNAs were inadvertently mixed, how might they be separated from one another?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. (Research Problem) The Nature and Roles of Linear Motifs in Proteins In addition to domains and modules, there are other significant sequence patterns in proteins—known as linear motifs—that are associated with a particular function. Consult the biochemical literature to answer the following questions: 1. What are linear motifs? 2. How are they different from domains?. 3. What are their functions? 4. How can they be characterized? 5. There are several papers that are good starting points for this problem. Neduva, V., and Russell, R., 2005. Linear motifs: evolutionary interaction switches. FEBS Letters 579:3342-3345. Gibson, T., 2009. Cell regulation: determined to signal discrete cooperation. Trends in Biochemical Sciences 34:471-482. Diella, K. Haslam, N., Chica., C. et aL, 2009. Understanding eukaryotic linear motifs and their role in cell signaling and regulation. Frontiers of Bioscience 13:6580-6603.arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Identify Proteins Using BLAST Searches of Peptide Fragment Sequences Go to the National Center for Biotechnology Information Web site at httlp:llhwww.ncbi.nlm.niih.goyl. From the menu (if Popular Resources on the right-hand side, click on “BLAST. Under the Basic BLAST heading on the new page that comes up, dick on protein blast. lit the Enter Query Sequence box at the top of the page that comes up, enter the following sequence: NQMMK.SR.N- LTKDRCKP. Confirm that the database under ChoOsC Search Set us set (111 nr (nonredundant protein Sequences), then click the BLAST button at the bottom (if the page td see the results of your search. Next, enter this sequence from a different protein: SLQTASAPDVYAlGfcCA. Identify the protein from which this sequence was derived.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
How to solve genetics probability problems; Author: Shomu's Biology;https://www.youtube.com/watch?v=R0yjfb1ooUs;License: Standard YouTube License, CC-BY
Beyond Mendelian Genetics: Complex Patterns of Inheritance; Author: Professor Dave Explains;https://www.youtube.com/watch?v=-EmvmBuK-B8;License: Standard YouTube License, CC-BY