Essentials of Genetics Plus Mastering Genetics with eText -- Access Card Package (9th Edition) (Klug et al. Genetics Series)
9th Edition
ISBN: 9780134047201
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 12, Problem 22PDQ
In a mixed
4/5C:1/5A | 4/5A:1/5C | ||
Proline | 63.0% | Proline | 3.5% |
Histidine | 13.0% | Histidine | 3.0% |
Threonine | 16.0% | Threonine | 16.6% |
Glutamine | 3.0% | Glutamine | 13.0% |
Asparagine | 3.0% | Asparagine | 13.0% |
Lysine | 0.5% | Lysine | 50.0% |
98.5% | 99.1% |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Let’s suppose you make a transposon library of the cellulose-secreting bacterium Komagataeibacter xylinus, with the goal of finding mutants that produce higher than normal amounts of cellulose, which would be useful industrially. However, despite your best efforts you are unable to isolate any transposon mutants that make more cellulose than the wild-type strain.Why might this have failed? List as many reasons as you can think of.
For the following five sequences, what is the consensus sequence?
5′–GGGAGCG–3′ 5′–GAGAGCG–3′ 5′–GAGTGCG–3′ 5′–GAGAACG–3′ 5′–GAGAGCA–3′
a. 5′–GGGAGCG–3′
b. 5′–GAGAGCG–3′
c. 5′–GAGTGCG–3′
d. 5′–GAGAACG–3′
In the procedure shown, why was it necessary to link thecoding sequence for the A or B chains to the sequence forβ-galactosidase? How were the A or B chains separated fromβ-galactosidase after the fusion protein was synthesized in E. coli?
Chapter 12 Solutions
Essentials of Genetics Plus Mastering Genetics with eText -- Access Card Package (9th Edition) (Klug et al. Genetics Series)
Ch. 12 - CASE STUDY | A drug that sometimes works A...Ch. 12 -
CASE STUDY | A drug that sometimes works
A...Ch. 12 -
CASE STUDY | A drug that sometimes works
A...Ch. 12 - HOW DO WE KNOW? In this chapter, we focused on the...Ch. 12 - Review the Chapter Concepts list on p. 215. These...Ch. 12 - In studies of frameshift mutations, Crick,...Ch. 12 -
4. The mRNA formed from the repeating...Ch. 12 - In studies using repeating copolymers, AC......Ch. 12 - Prob. 6PDQCh. 12 - Prob. 7PDQ
Ch. 12 -
8. When the amino acid sequences of insulin...Ch. 12 - Prob. 9PDQCh. 12 - Why doesn't polynucleotide phosphorylase (Ochoa's...Ch. 12 - Refer to Table 12.1. Can you hypothesize why a...Ch. 12 -
12. Predict the amino acid sequence produced...Ch. 12 - A short RNA molecule was isolated that...Ch. 12 - A glycine residue exists at position 210 of the...Ch. 12 - Shown here is a theoretical viral mRNA sequence...Ch. 12 -
16. Most proteins have more leucine than...Ch. 12 - Define the process of transcription. Where does...Ch. 12 - Describe the structure of RNA polymerase in...Ch. 12 - In a written paragraph, describe the abbreviated...Ch. 12 - Messenger RNA molecules are very difficult to...Ch. 12 - One form of posttranscriptional modification of...Ch. 12 - In a mixed copolymer experiment, messages were...Ch. 12 -
23. Shown in this problem are the amino acid...Ch. 12 - Alternative splicing is a common mechanism for...Ch. 12 - The genetic code is degenerate. Amino acids are...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What is single-cell protein? Explain the reasons for the removal or reduction of nucleic acid in Single Cell Protein.arrow_forwardFor E. coli strains with the lac genotypes show below, use a plus sign (+) to indicate the synthesis of β-galactosidase and permease and a minus sign (–) to indicate no synthesis of the proteins.arrow_forwardIn as1 mutant, assign secondary structure and tell how many alpha helices and beta-pleated sheets there is on the model.arrow_forward
- Based on the following wild type sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table). Wild Type: GUC GCC GAC GAG AGG Mutant 1: GUC GCC AGA CGA GAG G Mutant 2: GUC GCC ACG AGA GG Mutant 3: GUC GCC AAC GAG AGG Mutant 4: GUA GCC GAC GAG AGG Mutant 5: GUC GCC GAC UAG AGGarrow_forwardIn a heteropolymer experiment using 1/2C:1/4A:1/4G,how many different triplets will occur in the syntheticRNA molecule? How frequently will the most frequenttriplet occur?arrow_forwardHow can the binding assay technique be used to assign coding triplets to the corresponding amino acids?arrow_forward
- Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′arrow_forwardIn a genomic analysis looking for a specific disease gene,one candidate gene was found to have a single-base-pairsubstitution resulting in a nonsynonymous amino acidchange. What would you have to check before concluding that you had identified the disease-causing gene?arrow_forwardBelow is a portion of an exon from a gene that encodes protein X in the genome of the plant Arabidopsis. Wildtype DNA3’ TTC AAT GCT CCG AAT ACC 5’ template strand5’ AAG TTA CGA GGC TTA TGG 3’ non-template strand A new strain (Strain B) of Arabidopsis is identified with the same region of the gene coding for protein X: 3’ TTC AAT GCT CCC AAT ACC 5’ template strand5’ AAG TTA CGA GGG TTA TGG 3’ non-template strand Compare the two DNA sequences and look for any differences. Based on what you find a. There is no mutation in Strain B compared to Strain A. b. After the point of the mutation, all the amino acids encoded by the Strain B template will be different than the Strain A protein X. c. Protein X made from the Strain B template will be much shorter than protein X made from the Strain A template d. Protein X from Strain B will have one amino acid difference that would not affect protein function. e. There is a mutation but there will not be any difference in the…arrow_forward
- In as1 wild-type, what are the different secondary structures along with how many alpha helices and beta-pleated sheets there are in the model.arrow_forwardDescribe the common strategy (steps) for protein sequencing, starting with a biological sample containing many cell and biochemical substances. How prevalent are disulfide links in proteins? Why do the disulfide links need to be broken prior to sequencing? How can they be chemically broken?arrow_forwardIn a coding experiment using repeating copolymers, the following data were obtained. Copolymer Codons Produced Amino Acids in PolypeptideAG AGA, GAG Arg, GluAAG AGA, AAG, GAA Lys, Arg, Glu AGG is known to code for arginine. Taking into account the wobble hypothesis, assign each of the four remaining different triplet codes to its correct amino acid.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY