Concept explainers
Shown in this problem are the amino acid sequences of the wild type and three mutant forms of a short protein.
(a) Using Figure 12–7, predict the type of mutation that created each altered protein.
(b) Determine the specific ribonucleotide change that led to the synthesis of each mutant protein.
(c) The wild-type RNA consists of nine triplets. What is the role of the ninth triplet?
(d) For the first eight wild-type triplets, which, if any, can you determine specifically from an analysis of the mutant proteins? In each case, explain why or why not.
(e) Another mutation (mutant 4) is isolated. Its amino acid sequence is unchanged, but mutant cells produce abnormallylow amounts of the wild-type proteins. As specifically as you can, predict where this mutation exists in the gene.
Wild type: | met-trp-tyr-arg-gly-ser-pro-thr |
Mutant 1: | met-trp |
Mutant 2: | met-trp-his-arg-gly-ser-pro-thr |
Mutant 3: | met-cys-ile-val-val-val-gln-his |
Want to see the full answer?
Check out a sample textbook solutionChapter 12 Solutions
Essentials of Genetics Plus Mastering Genetics with eText -- Access Card Package (9th Edition) (Klug et al. Genetics Series)
- a. If a single transition occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence? b. If a single transversion occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence? c. If a single transition occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence? d. If a single transversion occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence?arrow_forwardWhich of these amino acid sequences will most likely favor the formation of a b-pleated sheet secondary structure?arrow_forwardA. What amino acid sequence is encoded by the codon sequence AUAAUGGUAACGGUU? B. Suppose the codon sequence AGACACUCUAUUAAA has a single base pair mutation to AGACACUCUUUUAAA. If the old protein sequence was Arg-His-Ser-Ile-Lys, what will be the new sequence encoded by the mutant gene?arrow_forward
- What type of bonding interaction causes stem-loops to form?arrow_forwardWhich amino acid is carried by the tRNA with the anticodon 5'-UCA-3'?arrow_forwardBased on the alignment of these protein sequences, which [pairs] of the genes appear to be most similar to each other? And give reasons why?arrow_forward
- using, 3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error on the amino acid chain?arrow_forwardConsider the following sequence of DNA: 3'-TTA CGG-5'What dipeptide is formed from this DNA after transcription and translation? b. If a mutation converts CGG to CGT in DNA, what dipeptide is formed? c. If a mutation converts CGG to CCG in DNA, what dipeptide is formed? d. If a mutation converts CGG to AGG in DNA, what dipeptide is formed?arrow_forwardGiven the partial transposons DNA sequence 5’-ACCGTATTCGGT-3’ upstream from the central region, assuming both terminal inverted repeats and flanking direct repeats have 6 base pairs, hypothetically write the transposon structure downstream from the central region.arrow_forward
- In the tertiary structure of tRNA, where is the anticodon region relative to the attachment site for the amino acid? Are these located adjacent to each other?arrow_forwardRemembering that the wobble base of the tRNA is the5′ base of the anticodon:a. In human tRNAs, what are the sequences of allpossible anticodons that were originally transcribedwith A in the wobble position? (Assume this A isalways modified to I.)b. In human tRNAs, what are the sequences of allpossible anticodons that were originally transcribedwith U in the wobble position? (Note: Any singletype of tRNA with a U at the wobble position canbe modified only in a single way.)c. How might the wobble Us in each of the anticodonsin (b) be modified and still be consistent with thegenetic code?d. What is the theoretical minimal number ofdifferent tRNA genes that must exist in thehuman genome? (Assume that xo5U pairs with A,G, or U only.)arrow_forwardWhy does a folded mutant protein aggregate rather than remain a misfolded monomer?arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning