Concept explainers
Northern blot analysis is performed on cellular mRNA isolated from E. coli. The probe used in the northern blot analysis hybridizes to a portion of the lacY sequence. Below is an example of the gel from northern blot analysis for a wild
a. Lac+ bacteria with the genotype
b. Lac- bacteria with the genotype
c. Lac- bacteria with the genotype
d. Lac+ bacteria with the genotype
e. Lac- bacteria with the genotype
f. Lac- bacteria with the genotype
g. Lac- bacteria with the genotype
Want to see the full answer?
Check out a sample textbook solutionChapter 12 Solutions
Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
- In this western blot, the levels of TBK remain constant with increasing amounts/expression of the viral protein (VP). Figure description: Increasing amounts of a plasmid expressing the viral protein (0.5, 1, or 2ug) were cotransfected with TBK1 expression plasmid. Cells were harvested 24 h post-transfection and analyzed for phosphorylated TBK1 (anti-pTBK1 Ser172), total TBK1 (anti-TBK1), B-actin (anti-B-actin), and viral protein (anti-VP) expression by Western blot analysis. VP PTBK1 (S172) TBK1 actin Virus proteins O True O Falsearrow_forwardYou are attempting to prepare a single gene knockout library using the pRL27 transposon system. You grow the donor E. coli in Luria broth containing both kanamycin and diaminopimelic acid (DAP) and your recipient Serratia rubidaea in plain Luria broth. You combine an equal ratio of donor and recipient cultures and plate the mixture onto Luria agar supplemented with DAP. After 24 hours incubation at 37°C, you create a cell slurry and plate the cells onto Luria agar aupplemented with kanamycin. After 24 hours incubation at 37°C, you find that no colonies grow. What best explains this outcome? A. Failure to supplement media with DAP B. Failure to remove antiobiotic containing media C. Failure to incubate for a sufficient length of time D. Failure to incubate at the appropiate temperature E. Failure to use the proper mating mix ratioarrow_forward7. Consider the following plasmid (size 6700 bp), with restriction sites at the positions indicated: BamHI + 1 6700 bp 2800 3500 EcoRI BamHI Probearrow_forward
- Many resistance mechanisms are encoded on plasmids. These mechanisms are of great clinical significance, because they can spread very easily through horizontal gene transfer. A culture of the bacterial isolate is grown, and plasmid DNA is isolated using a spin column-based solid phase extraction method. The purified plasmid DNA is then submitted for next-generation sequencing. Bioinformatic analyses of the sequencing results suggests that the following gene is likely involved in antibiotic resistance: > putative antibiotic resistance gene ATGCGTGTATTAGCCTTATCGGCTGTGTTTTTGGTGGCATCGATT ATCGGAATGCCTGCGGTAGCAAAGGAATGGCAAGAAAACAAAAGT TGGAATGCTCACTTTACTGAACATAAATCACAGGGCGTAGTTGTG CTCTGGAATGAGAATAAGCAGCAAGGATTTACCAATAATCTTAAA CGGGCGAACCAAGCATTTTTACCCGCATCTAGTGCGAAAATTCCC AATAGCTTGATCGCCCTCGATTTGGGCGTGGTTAAGGATGAACAC CAAGTCTTTAAGTGGGATGGACAGACGCGCGATATCGCCACTTGG AATCGCGATCATAATCTAATCACCGCGATGAAATATTCAGTTGTG CCTGTTTATCAAGAATTTGCCCGCCAAATTGGCGAGGCACGTATG…arrow_forwardPlease DESCRIBE, in outline form, the method you will use to select for bacterial cells that have taken up the pL311 plasmid, and to screen those cells for the presence of plasmids that are likely to contain a cloned gene. Be sure to mention the specific media you will use. In addition, please explain the rationale behind this specific selection and screening procedure. (Remember that you have available the following types of media: (i) media containing neither kanamycin nor X-gal, (ii) media containing BOTH kanamycin and X-gal, (iii) media containing tetracycline, and (iv) media containing ampicillin.arrow_forwardBacteriophage lambda (λ) consists primarily of a head, which contains the genomic DNA, and a tail that is involved in phage attachment to bacterial cells. The diagram to the right represents the bacteriophage lambda genomic DNA, showing the locations of important gene clusters (Ausubel et al. 1998). Arrows below mark the sites where the restriction enzyme HindIII cuts the DNA, and the numbers indicate the number of base pairs in each fragment. The restriction enzyme HindIII cuts the λ genome 7 times, how many fragments are produced following this reaction?arrow_forward
- From one Escherichia coli strain, five Hfr strains were isolated. The location and orientation of the origin of transfer of each Hfr strain are shown in Figure 1. want to use these five strains to map the locus responsible for thiamine synthesis, called thi. Each Hfr strain is sensitive to rifampicin (RifS) and Thi+. Conjugation experiments are performed between each of the Hfr strains and an F- RifR Thi 9 leu 10 20 30 nadD pyrC trp 40 his 50 60 70 cysG 80 90 metA 100 Hfr1 Hfr2 Hfr3 Hfr4 Hfr5 Figure 1: Chromosome map of Escherichia coli. Five Hfr strains (Hfr1 to Hfr5) were isolated and the location and orientation of the origin of transfer is shown by the arrows in each Hfr strain. Distances in minutes are indicated. Leu: leucine biosynthesis; nadD: NAD biosynthesis; pyrC: pyrimidine biosynthesis; trp: tryptophan biosynthesis; his: histidine biosynthesis; cysG: cysteine biosynthesis; metA: biosynthesis of methionine. 1) What is the selection medium used in these conjugation…arrow_forwardFrom one Escherichia coli strain, five Hfr strains were isolated. The location and orientation of the origin of transfer of each Hfr strain are shown in Figure 1. want to use these five strains to map the locus responsible for thiamine synthesis, called thi. Each Hfr strain is sensitive to rifampicin (RifS) and Thi+. Conjugation experiments are performed between each of the Hfr strains and an F- RifR Thi leu 10 20 T nadD pyrC trp 30 his Donor strain Hfr1 Hfr2 Hfr3 Hfr4 Hfr5 The results are shown in the following table 60 70 cysG Colonies Thi 1000 0 400 0 25 80 90 metA 1,00 Hfr1 Hfr2 Figure 1: Chromosome map of Escherichia coli. Five Hfr strains (Hfr1 to Hfr5) were isolated and the location and orientation of the origin of transfer is shown by the arrows in each Hfr strain. Distances in minutes are indicated. Hfr 3 Leu: leucine biosynthesis; nadD: NAD biosynthesis; pyrC: pyrimidine biosynthesis; trp: tryptophan biosynthesis; his: histidine biosynthesis; cysG: cysteine biosynthesis; metA…arrow_forwardFor E. coli strains with the lac genotypes show below, use a plus sign (+) to indicate the synthesis of β-galactosidase and permease and a minus sign (–) to indicate no synthesis of the proteins.arrow_forward
- Describe the steps, starting from an endonuclease digested DNA sample, to complete a Southern blot experiment. What difference would a Northern blot have?arrow_forwardCre-Lox system is used for site-specific modification of DNA for genetic engineering applications. The reporter gene construct shown below is used to test the Cre-Lox system. Cells are transfected with the construct shown below and the activity of the constructs is determined by visualizing the cells with a fluorescence microscope. Match the following conditions with the expected cell observations. Hint: Make sure you note the position of the Start and Stop. The GFP and RFP genes shown do not have start codons. Cre/Lox Reporter Gene ATG LoxP CMV-Pro A. No Expression GFP Stop B. GFP Only LoxP Absence of Cre Cells treated with drug that induces expression of Cre RFP C. RFP Only A. Image A B. Image B C. Image C D Image D express ? D. RFP and GFParrow_forwardThe DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′ endsare at left). Using this information, what is the sequence of the wild-type gene in this region?mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCGmutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCGmutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCGarrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education