Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
3rd Edition
ISBN: 9780135564172
Author: Mark Sanders, John Bowman
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 12, Problem 26P
Suppose that base substitution mutations sufficient to eliminate the function of the operator regions listed below were to occur. For each case, describe how transcription or life cycle would be affected.
a. lacO mutation in E. coli
b.
c.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Consider a mutation in -10 BOX promoter consensus sequence (TATAAT) in the prokaryote recA gene where the first T base mutated to G, what outcome(s) are likely?
a.
transcription levels will increase as the GC content would increase
b.
this mutation is silent, so no change in transcription level
c.
transcription levels would decrease because the promoter would be weaker
d.
transcription levels do not depend on the promoter sequence for the gal gene
e.
nothing would happen because the promoter would not change the mRNA sequence
Define the following terms: a. promoter b. consensus sequence c. operon d. chromatin-remodeling complex e. general transcription factors
Suppose that E. coli sustains a mutation in its gene for the lac operon repressor such that the repressor is ineffective. What effect would this have on the bacterium’s ability to catabolize lactose? Would the mutant strain have an advantage over wild-type cells? Explain your answer.
Chapter 12 Solutions
Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
Ch. 12 - 12.1 Bacterial genomes frequently contain groups...Ch. 12 - Transcriptional regulation of operon gene...Ch. 12 - Why is it essential that bacterial cells be able...Ch. 12 - Identify similarities and differences between an...Ch. 12 - The transcription of -galactosidase and permease...Ch. 12 - 12.6 Is attenuation the product of an allosteric...Ch. 12 - The trpL region contains four repeated DNA...Ch. 12 - The CAP binding site in the lac promoter is the...Ch. 12 - What role does cAMP play in transcription of lac...Ch. 12 - How would a cap- mutation that produces an...
Ch. 12 - Explain the circumstances under which attenuation...Ch. 12 - Consider the transcription of genes of the...Ch. 12 - Describe the lytic and lysogenic life cycles of ...Ch. 12 - 12.14 Define antisense RNA, and describe how it...Ch. 12 - 12.15 Attenuation of trp operon transcription is...Ch. 12 - 12.16 In the lac operon, what are the likely...Ch. 12 - Identify which of the following lac operon haploid...Ch. 12 - Prob. 18PCh. 12 - 12.19 List possible genotypes for lac operon...Ch. 12 - Suppose each of the genotypes you listed in parts...Ch. 12 - 12.21 Four independent mutants (mutants A to D)...Ch. 12 - Suppose the lac operon partial diploid...Ch. 12 - What is a riboswitch? Describe the riboswitch...Ch. 12 - 12.24 A repressible operon system, like the trp...Ch. 12 - 12.25 What is the likely effect of each of the...Ch. 12 - 12.26 Suppose that base substitution mutations...Ch. 12 - 12.27 Two different mutations affect. Mutant...Ch. 12 - How would mutations that inactivate each of the...Ch. 12 - The bacterial insertion sequence IS 10 uses...Ch. 12 - For an E. coli strain with the lac operongenotype...Ch. 12 - 12.31 How could antisense RNA be used as an...Ch. 12 - 12.32 Section describes the function of tRNA...Ch. 12 - The following hypothetical genotypes have genes A,...Ch. 12 - 12.34 Northern blot analysis is performed on...Ch. 12 - Prob. 35PCh. 12 - Prob. 36PCh. 12 - 12.37 The electrophoresis gel shown in part (a) is...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The following diagram represents a transcription unit on a DNA molecule. a. Assume that this DNA molecule is from a bacterial cell. Draw the approximate locations of the promoter and terminator for this transcription unit. b. Assume that this DNA molecule is from a eukaryotic cell. Draw the approximate location of an RNA polymerase II promoter.arrow_forwardE. coli has five genes that code for enzymes that make tryptophan. These genes are regulated by a single promoter and transcribed as one long gene. The presence of tryptophan shut down the production of tryptophan by the cell by binding to the repressor. This changes the repressors shape allowing it to bind to DNA operator, blocking RNA polymerase and cutting off the production of tryptophan. a. Describe what woud happen to the operon if some of the cells had a mutation on the repressor, not allowing it to bind with tryptophan. The repressor is described as an allosteric protein. What does this mean? b. Does the tryptophan model demonstrate an inducible or repressible operon? What is your evidence? *arrow_forwardThe following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.arrow_forward
- The MRNA for a mammalian peptide that enhances electrolyte transfer to reduce paralysis was spliced then reversed transcribed and the CDNA ligated into a phage and transfected into host bacteria cells. The host then transcribed and translated this. The protein product however was non-functional. What is the most probable reason for this result? A. Absence of post-transcriptional modification in bacterial cells B. Differences in the post-translational mechanisms in eukaryotes and prokaryotes. C. Differences in the translational mechanisms involved in prokaryotes, e.g. 70 S ribosome vs 80S ribosome. D. The mRNA did not contain a promoter region to allow peptide translation. E. Insertion of portions of the phage DNA which added sequences for amino acids changing the function of the protein product.arrow_forwardE. coli has five genes that code for enzymes that make tryptophan. These genes are regulated by a single promoter and transcribed as one long gene. The presence of tryptophan shut down the production of tryptophan by the cell by binding to the repressor. This changes the repressors shape allowing it to bind to DNA operator, blocking RNA polymerase and cutting off the production of tryptophan. a. Describe what would happen to the operon if some of the cells had a mutation on the repressor, not allowing it to bind with tryptophan. The repressor is described as an allosteric protein. What does this mean? b. Does the tryptophan model demonstrate an inducible or repressible operon? What is your evidence?*arrow_forwardThe promoter consensus sequence at the -10 BOX in the bio gene in E. coli was TAGACT; however, a transversion occurred which changed the G nucleotide to T, what outcome(s) are likely? a. transcription levels would decrease because the promoter would be weaker b. nothing would happen because the promoter would not change the mRNA sequence c. the mutation would block RNA polymerase from binding to the DNA d. transcription levels would increase because the promoter would be stronger e. the bio gene does not require a functional promoterarrow_forward
- Select the events from eukaryotic transcription from the list below and list them below in order, by letter, from earliest to latest during transcription. A. Sigma factor binds 5'TTGACA?' B. Rho separates DNA/RNA hybrid C. TFIID binds TATA Box D. RNA Pol Il binds E. Holoenzyme forms F. Template strand is used to synthesize a 5' to 3' polymer G. Transcript is moved into the cytoplasm H. U1, U2, U4, U5 and U6 sn RNPs bind transcriptarrow_forwardWhat are two reasons that a eukaryotic gene (e.g. Green Fluorescent Protein in jellyfish) will not be expressed if it is inserted into a bacterial genome with no alterations? a. Bacterial genes do not contain introns b. Bacterial promoters have different consensus sequences than eukaryotic ones c. Transcription of this gene is affected by the simultaneous processes of transcription and translation d.arrow_forwardConsider a gene sequence whose promoter has acquired a mutation. Although this is a problem, this will not cause a missense mutation. Explain why the outcome in this scenario is NOT a missense mutation. Describe the purpose of a gene's promoter.arrow_forward
- For the trp operon, determine whether genes will be expressed (on) or silenced (off) given the following: a. Tryptophan levels are high. b. The trp repressor can no longer bind tryptophan.arrow_forwardListed in parts a through g are some mutations that were found in the 5′ UTR of the trp operon of E. coli. What will the most likely effect of each of these mutations be on the transcription of the trp structural genes? a. A mutation that prevents the binding of the ribosome to the 5′ end of the mRNA 5′ UTR b. A mutation that changes the Trp codons in region 1 of the mRNA 5′ UTR into codons for alanine c. A mutation that creates a stop codon early in region 1 of the mRNA 5′ UTR d. Deletions in region 2 of the mRNA 5′ UTR e. Deletions in region 3 of the mRNA 5′ UTR f. Deletions in region 4 of the mRNA 5′ UTR g. Deletion of the string of adenine nucleotides that follows region 4 in the 5′ UTRarrow_forwardINTERPRET DATA Develop a simple hypothesis that would explain the behavior of each of the following types of mutants in E. coli. Mutant a: The map position of this mutation is in the trp operon. The mutant cells are constitutive; that is, they produce all the enzymes coded for by the trp operon, even if large amounts of tryptophan are present in the growth medium. Mutant b: The map position of this mutation is in the trp operon. The mutant cells do not produce any enzymes coded for by the trp operon under any conditions. Mutant c: The map position of this mutation is some distance from the trp operon. The mutant cells are constitutive; that is, they produce all the enzymes coded for by the trp operon, even if the growth medium contains large amounts of tryptophan.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license