![Pearson eText Biology: Life on Earth with Physiology -- Instant Access (Pearson+)](https://www.bartleby.com/isbn_cover_images/9780135755785/9780135755785_largeCoverImage.gif)
Pearson eText Biology: Life on Earth with Physiology -- Instant Access (Pearson+)
12th Edition
ISBN: 9780135755785
Author: Gerald Audesirk, Teresa Audesirk
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 12, Problem 3MC
Summary Introduction
Introduction:
Mutation is defined as the permanent alteration in the
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Match the process to mutation.
a. mutation
b. point mutation
c. frameshift mutation
f. nonsense mutation
g. inversion
h. deletion
i. reciprocal translocation
j. duplication
d. silent mutation
e. missense mutation
61. A nucleotide change that does not lead to an amino acid change.
62. There is a change in a single base pair of nucleotides.
63. A nucleotide sequence is repeated and added into the chromosome.
64. A segment from one chromosomes is broken and added into another chromosome.
a. This piece of DNA is cut by EcoRI, the resulting fragments are separated by gel electrophoresis, and the gel is stained with ethidium bromide. Draw a picture of the bands that will appear on the gel. b. If a mutation that alters EcoRI site 1 occurs in this piece of DNA, how will the banding pattern on the gel differ from the one that you drew in part a? c. If mutations that alter EcoRI sites 1 and 2 occur in this piece of DNA, how will the banding pattern on the gel differ from the one that you drew in part a? d. If 1000 bp of DNA were inserted between the two restriction sites, how would the banding pattern on the gel differ from the one that you drew in part a? e. If 500 bp of DNA between the two restriction sites were deleted, how would the banding pattern on the gel differ from the one that you drew in part a?
Which of the following does not contribute to the stability of the DNA?
A. The presence of hydrogen between nitrogenous bases.
B. Presence of the N-glycosidic bond between the nitrogenous base and phosphate group
C. Presence of phosphodiester bond between the sugar and phosphate group on the sugar-phosphate backbone.
D. Hydrophobic interaction between stacked nitrogenous bases.
Chapter 12 Solutions
Pearson eText Biology: Life on Earth with Physiology -- Instant Access (Pearson+)
Ch. 12.1 - Which do you think would be more difficult to...Ch. 12.1 - If viral genetic material had the same structure...Ch. 12.1 - Prob. 1CYLCh. 12.1 - Prob. 2CYLCh. 12.2 - Muscles, Mutations, and Myostatin The sequence of...Ch. 12.2 - Prob. 1CYLCh. 12.3 - describe the process of DNA replication, including...Ch. 12.3 - explain why DNA replication is called...Ch. 12.3 - Muscles, Mutations, and Myostatin "Double-muscled"...Ch. 12.4 - How Much Genes Influence Athletic Prowess?
Ch. 12.4 - explain what mutations are and how they occur?Ch. 12.4 - explain why mutations are rare?Ch. 12.4 - describe the different types of mutations?Ch. 12.4 - Prob. 1TCCh. 12 - If a parental DNA strand has the base sequence...Ch. 12 - Prob. 2MCCh. 12 - Prob. 3MCCh. 12 - The rungs of the DNA double helix consist of a....Ch. 12 - Prob. 5MCCh. 12 - Prob. 1FIBCh. 12 - Prob. 2FIBCh. 12 - Prob. 3FIBCh. 12 - Prob. 4FIBCh. 12 - Prob. 5FIBCh. 12 - Prob. 6FIBCh. 12 - Prob. 1RQCh. 12 - Prob. 2RQCh. 12 - Describe the structure of DNA. Where are the...Ch. 12 - Prob. 4RQCh. 12 - Describe the process of DNA replication.Ch. 12 - How do mutations occur? Describe the principal...Ch. 12 - Prob. 1ACCh. 12 - Genetic information is encoded in the sequence of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 1. A.) Deletion mutation is a loss of a single base by damage. B.) Point mutation is when a nucleotide is paired with a wrong nucleotide during RNA replication. a. Statement A is correct b. Statement B is correct c. Both A and B are correct d. Both A and B are incorrect Answer: 2. This is a process that produces a change in the structure of the DNA by forming adenine rather than guanine. a. Reverse transcription of guanine b. Alkylation of the 06-Guanine c. Reverse translation of guanine d. Methylation of guanine bases Answer: 3. This type of DNA repair happens when you are removing a single damaged base of DNA strand. a. Nucleotide repair b. Base excision repair c. Strand break repair d. Base nucleotide replacement Answer:arrow_forwardThe function of DNA ligase is to: a. Catalyze formation of phosphodiester bonds between adjacent nucleotides b. Catalyze formation of hydrogen bonds between adjacent nucleotides c. Keep single strands of DNA apart during replication d. Facilitate base pairing between single stranded molecules in DNA e. Both a. and d. are correctarrow_forwardThe most important force for stability of the DNA double helix is: a. Disulfide bond b. Hydrophilic interactions c. electrostatic interaction d. Base stackingarrow_forward
- 1. Suicide enzyme will take in the alkyl group through its carbon atom from a cysteine residue. a. True b. False Answer: 2. These are the consequences of the changes in the messenger codon nucleotide sequence. a. Recombination b. Mutation c. Disease d. Abnormality Answer: 3. A.) Damaged DNA can be reversed if nucleotides can be replaced with a proper nucleotide for a correct amino acid base. B.) Direct reversal of DNA repair can destroy the abnormal bonds of the nucleotides in the DNA sequence. a. Statement A is correct b. Statement B is correct c. Both A and B are correct d. Both A and B are incorrect Answer:arrow_forwardWhich statement about Okazaki fragments is true? Select one: a. DNA polymerase doesn’t need a primer to build these fragments b. They act as a primer that initiates DNA replication. c. They correct errors made during earlier phases of DNA replication. d. They are necessary because DNA polymerase can only build DNA in the 5’ to 3’ direction, so for one of the strands at each fork, the DNA polymerase can only buildaway from the fork. e. They prevent the ends of chromosomes from shortening with every replication.arrow_forwardPlace the following steps of DNA replication and repair in the correct order by numbering them from 1 to 5. a. A template strand begins to be replicated. b. If the incorrect base is not identified and replaced, it remains as a point mutation in the DNA. c. DNA polymerase identifies and replaces most incorrect bases with the correct base, complementary to the base on the template strand. d. An incorrect base is added to the growing strand of DNA. e. Proteins identify and replace any incorrect bases missed by DNA polymerase.arrow_forward
- Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…arrow_forwardA. Changes and damages to the DNA is permanent and has no remedy.B. Damage to the DNA can be reversed via replacing the damaged nucleotides in the DNA sequence. a. Statement A is correctb. Statement B is correctc. Both A and B are correctd. Both A and B are incorrectarrow_forwardWhich of the following statements is not true? Explain why. A. A DNA strand can serve as a template strand on many occasions. B. Following semiconservative DNA replication, one strand is a newly made daughter strand and the other strand is a parental strand. C. A DNA double helix may contain two strands of DNA that were made at the same time. D. A DNA double helix obeys the AT/GC rule. E. A DNA double helix could contain one strand that is 10 generations older than its complementary strand.arrow_forward
- Topoisomerases are enzymes that can: a. join two DNA fragments to become one. b. catalyze conformational change of a protein. c. cut DNA at specific site. d. catalyze the breaking and rejoining of DNA strands which produces DNA that is either more or less superhelical than the original.arrow_forwardWhich of the following types of DNA damage would be hardest to repair using the DNA repair pathways?A. Complete removal of three nucleotides in the middle of one strand.B. A covalent bond between a base on one strand and a base on the complementary strand.C. Incorporation of a sugar other than deoxyribose into one strand.D. Covalent attachment of a short polypeptide to a single base.E. A covalent bond between a base and a deoxyribose on the same strand. Please explain why it's Barrow_forward#1 under Identify the Structures is what.... A. original strands of DNA B. backbone of DNA C. nitrogen bases D. new copied strand of DNAarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY