Gen Combo Ll Biology; Connect W/learnsmart Labs Access Card
4th Edition
ISBN: 9781259853197
Author: Robert Brooker
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 12.4, Problem 3EQ
Summary Introduction
To determine: The result which Nirenberg and Leder would have found out for the triplets AUG, UAA, UAG and UGA.
Introduction: In the Nirenberg and Leder experiment, the triples were found to have the special characteristics of causing the tRNA molecule to bind to a ribosome. The two scientists, Nirenberg and Leder discovered the concept of triplets in the mRNA molecules. The triplet is the RNA molecules containing the set of three
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…
The human genome contains approximately 106 copies of an Alusequence, one of the best-studied classes of short interspersed elements(SINEs), per haploid genome. Individual Alu units share a282-nucleotide consensus sequence followed by a 3@adenine@richtail region [Schmid (1998)]. Given that there are approximately3 * 10^9 base pairs per human haploid genome, about how manybase pairs are spaced between each Alu sequence?
Briefly explain the frameshift mutation ?
Chapter 12 Solutions
Gen Combo Ll Biology; Connect W/learnsmart Labs Access Card
Ch. 12.1 - What disease would result if a person inherited...Ch. 12.1 - Prob. 2CCCh. 12.1 - What is the direction of flow of genetic...Ch. 12.2 - Prob. 1CCCh. 12.2 - Core Skill: Connections Look back at the role of...Ch. 12.3 - Prob. 1CCCh. 12.4 - Prob. 1CCCh. 12.4 - Prob. 2CCCh. 12.4 - Prob. 1EQCh. 12.4 - Prob. 2EQ
Ch. 12.4 - Prob. 3EQCh. 12.5 - Prob. 1CCCh. 12.5 - Core Skill: Connections Look back at Figure 6.3,...Ch. 12.5 -
Figure 12.17 Comparison of small subunit rRNA...Ch. 12.6 - Prob. 1CCCh. 12 - Which of the following best represents the central...Ch. 12 - A mutation prevents a gene from being transcribed...Ch. 12 - Prob. 3TYCh. 12 - Prob. 4TYCh. 12 - If a eukaryotic mRNA failed to have a cap attached...Ch. 12 - Prob. 6TYCh. 12 - Prob. 7TYCh. 12 - During the initiation of translation, the first...Ch. 12 - Prob. 9TYCh. 12 - Prob. 10TYCh. 12 - Prob. 1CQCh. 12 - Prob. 2CQCh. 12 - Prob. 3CQCh. 12 - Prob. 1COQCh. 12 - Prob. 2COQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Payne, B. A. et al. (2013) present evidence that a low level of heteroplasmic mtDNA exists in all tested healthy individuals. (a) What are two likely sources of such heteroplasmy? (b) What genetic conditions within a given mitochondrion are likely to contribute to such a variable pool of mitochondria?arrow_forwardA light year is approximately 9.46 x 1012 kilometres. Calculate in light years, the approximate total length of DNA in all the undergraduate students studying at Cardiff University given that: (i) the human haploid genome comprises approx. 3.2 x 109 base-pairs (bp) DNA; (ii) 10 bp of DNA has a length of approx. 3.4 nm, (iii) an adult human is constructed from about 3.7 x 1013 cells (Bianconi et al, (2013), Ann Hum Biol 40, 463–471). (iv) There are approx. 23,800 undergraduate students at the University. Show your calculations in full.arrow_forwardFour cosmid clones, which we will call cosmids A, B, C, and D, werehybridized to each other in pairwise combinations. The insert size ofeach cosmid was also analyzed. The following results were obtained:arrow_forward
- The genome of Daphnia pulex, a small freshwater crustacean, includesapproximately 30,000 genes in ∼200,000 kb of DNA. How does the genome compare to that of Drosophila melanogaster, another arthropod, and to that of humans?arrow_forwardHow BLAST Searches Automate the Findingof Homologous Sequences?arrow_forwardGiven the fact that 1 fg of DNA = 9.78 * 105base pairs (on average), you can convert the amount of DNA per cell to the lengthof DNA in numbers of base pairs. (a) Calculate the number of basepairs of DNA in the haploid yeast genome. Express your answer inmillions of base pairs (Mb), a standard unit for expressing genomesize. Show your work. (b) How many base pairs per minute weresynthesized during the S phase of these yeast cells?arrow_forward
- SDS-PAGE and Agarose gel electrophoresis can both be used to separate proteins or protein- complexes based on their size. Separation of a multi-subunit protein complex by SDS-PAGE resulted in two bands with molecular weights of 86 KDa and 136 KDa, while separation of the same complex using Agarose gel electrophoresis resulted in two bands with molecular weights of 222 KDa and 444 KDa. Based on this information, which of the following statements is most likely to be correct? O The complex has a molecular weight of 222 KDa O The complex exists as a dimer of homo-dimers O The complex exists as a dimer of hetero-dimers SE O The complex exists as a trimer, but the individual protein subunits are covalently crosslinked to each otherarrow_forwardConsider the following distance matrix: A B C D A B C D ☆ 0.1 0.4 0.3 0.8 0.6 0.2 Using the UPGMA algorithm, answer the following questions: a) What two sequences are the most related? Which are the least related? b) Does the following tree accurately capture the relationship among the sequ in the distance matrix (ignoring branch lengths)? Explain in detail why or whyarrow_forwardQ-)Silent mutations that occur in DNA are quite common in living cells and usually involve no effects onphenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provideanswers for the following questions? A) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect onthe phenotype and provide a brief description of its molecular characteristics?arrow_forward
- Using sickle-cell anemia as a basis, describe what is meant by a genetic or inherited molecular disease. What are the similarities and dissimilarities between this type of a disorder and a disease caused by an invading microorganism?arrow_forwardGive typing answer with explanation and conclusion what is different about a) the number of variant sites and b) the pattern of linkage disequilibrium (LD) when we compare african to non- african genomes?arrow_forwardHidden Markov Model (HMM) Construct the HMM for the following sequences 2) G C A A A A G A A T G C A A G A The matches are considered for the columns [1, 2,4,5, and 7]arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY