Owlv2,1 Term Printed Access Card For Campbell/farrell/mcdougal's Biochemistry, 9th
Owlv2,1 Term Printed Access Card For Campbell/farrell/mcdougal's Biochemistry, 9th
9th Edition
ISBN: 9781305962972
Author: Campbell, Mary K.; Farrell, Shawn O.; Mcdougal, Owen M.
Publisher: Cengage Learning
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 13, Problem 37RE

REFLECT AND APPLY Each of the following pairs of primers has a problem with it. Tell why the primers would not work well.

(a) Forward primer 5' GCCTCCGGAGACCCATTGG 3' Reverse primer

5' TTCTAAGAAACTGTTAAGG 3'

(b) Forward primer 5' GGGGCCCCTCACTCGGGGCCCC 3' Reverse primer

5' TCGGCGGCCGTGGCCGAGGCAG 3'

(c) Forward primer 5' TCGAATTGCCAATGAAGGTCCG 3' Reverse primer

5' CGGACCTTCATTGGCAATTCGA 3'

Blurred answer

Chapter 13 Solutions

Owlv2,1 Term Printed Access Card For Campbell/farrell/mcdougal's Biochemistry, 9th

Ch. 13 - RECALL What are three differences between the...Ch. 13 - RECALL What are sticky ends? What is their...Ch. 13 - RECALL What would be an advantage of using HaeIII...Ch. 13 - RECALL Describe the cloning of DNA.Ch. 13 - RECALL What vectors can be used for cloning?Ch. 13 - RECALL Describe the method you would use to test...Ch. 13 - RECALL What is blue/white screening? What is the...Ch. 13 - Prob. 18RECh. 13 - Prob. 19RECh. 13 - Prob. 20RECh. 13 - Prob. 21RECh. 13 - Prob. 22RECh. 13 - Prob. 23RECh. 13 - REFLECT AND APPLY What are the requirements for an...Ch. 13 - Prob. 25RECh. 13 - Prob. 26RECh. 13 - REFLECT AND APPLY The genes for both the a- and...Ch. 13 - REFLECT AND APPLY Outline the methods you would...Ch. 13 - Prob. 29RECh. 13 - Prob. 30RECh. 13 - Prob. 31RECh. 13 - Prob. 32RECh. 13 - RECALL Why is temperature control so important in...Ch. 13 - RECALL Why is the use of temperature-stable DNA...Ch. 13 - RECALL What are the criteria for good primers in a...Ch. 13 - REFLECT AND APPLY What difficulties arise in the...Ch. 13 - REFLECT AND APPLY Each of the following pairs of...Ch. 13 - RECALL What is qPCR?Ch. 13 - Prob. 39RECh. 13 - REFLECT AND APPLY Suppose that you are a...Ch. 13 - REFLECT AND APPLY Why is DNA evidence more useful...Ch. 13 - REFLECT AND APPLY Give the DNA sequence for the...Ch. 13 - Prob. 43RECh. 13 - Prob. 44RECh. 13 - Prob. 45RECh. 13 - Prob. 46RECh. 13 - Prob. 47RECh. 13 - RECALL Has proteomic analysis been done on...Ch. 13 - Prob. 49RECh. 13 - Prob. 50RECh. 13 - Prob. 51RECh. 13 - RECALL What are the key differences between DNA...
Knowledge Booster
Background pattern image
Biochemistry
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
  • Text book image
    Biochemistry
    Biochemistry
    ISBN:9781305961135
    Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
    Publisher:Cengage Learning
Text book image
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY