Pearson eText Biology: Life on Earth with Physiology -- Instant Access (Pearson+)
12th Edition
ISBN: 9780135755785
Author: Gerald Audesirk, Teresa Audesirk
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 13, Problem 5FIB
Summary Introduction
Introduction:
The proteins are synthesized by the process known as the translation, which occurs in the cytoplasm. During the process of translation, the base sequence of
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
During the initiation of translation, the ribosome assembles on an mRNA strand with the start codon (AUG) positioned at the ____________ site, and the next codon positioned at the _____________ site.
Translation begins with the_______ codon of mRNAand continues until a(n)_______ codon is reached. Individual amino acids are brought to the ribosome by______. These amino acids are linked into protein by _______bonds.
The first codon in a mRNA will be ____ and will code for ___ and the final codon will be ______ and will signify _____
Chapter 13 Solutions
Pearson eText Biology: Life on Earth with Physiology -- Instant Access (Pearson+)
Ch. 13.1 - describe three types of RNA that play roles in...Ch. 13.1 - Prob. 2CYLCh. 13.1 - Prob. 3CYLCh. 13.2 - Prob. 1TCCh. 13.2 - Prob. 1CYLCh. 13.2 - Prob. 2CYLCh. 13.2 - describe an example of post-transcription...Ch. 13.3 - Prob. 1TCCh. 13.3 - Prob. 1CSCCh. 13.3 - Prob. 1CYL
Ch. 13.3 - Prob. 2CYLCh. 13.3 - Prob. 3CYLCh. 13.3 - Prob. 4CYLCh. 13.4 - Prob. 1CSCCh. 13.4 - describe three different types of mutations?Ch. 13.4 - Prob. 2CYLCh. 13.5 - Prob. 1HYEWCh. 13.5 - Envision yourself as a physician. A mother,...Ch. 13.5 - Prob. 2TCCh. 13.5 - Prob. 1CYLCh. 13.5 - Prob. 2CYLCh. 13.5 - Prob. 3CYLCh. 13.5 - Prob. 4CYLCh. 13.5 - Prob. 1CTCh. 13 - Prob. 1MCCh. 13 - Which of the following is not true of RNA? a. It...Ch. 13 - Prob. 3MCCh. 13 - Prob. 4MCCh. 13 - Prob. 5MCCh. 13 - Synthesis of RNA from the instructions in DNA is...Ch. 13 - Prob. 2FIBCh. 13 - Prob. 3FIBCh. 13 - Prob. 4FIBCh. 13 - Prob. 5FIBCh. 13 - If a nucleotide is replaced by a different...Ch. 13 - Prob. 1RQCh. 13 - Name the three types of RNA that are essential to...Ch. 13 - Prob. 3RQCh. 13 - Prob. 4RQCh. 13 - Prob. 5RQCh. 13 - Prob. 6RQCh. 13 - Prob. 7RQCh. 13 - Define mutation. Describe four different effects...Ch. 13 - Prob. 1ACCh. 13 - Prob. 2AC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNAarrow_forwardIn the initiation of translation, the process always lines up at the start codon. What is the start codon? _______ What does the initiator tRNA do? The subunits of the ______________ then bind together around the mRNA and initiator tRNA.arrow_forwardOccurring in the nucleus ribosome mitochondrion , translation transcription is the process of making an RNA copy from a DNA template. The molecule then enters the cytoplasm. The process in which the mRNA sequence is converted into a sequence of amino acids is called translation transcription . In the cytoplasm, the nucleus ribosome mitochondrion reads the amino acid sequence and assembles the protein.arrow_forward
- The RNA sequence below encodes a very short protein: 5’ ACCGUACGACCAUGUCCCACUAUCCCUAGGCGAUC 3’ Circle the codon where translation (protein synthesis) by the ribosome will start. Put a box around the codon where it will stop. Use the genetic code table in your text to decode this message: what will be the sequence of amino acids in the protein?arrow_forwardAmino acids are translated from mRNA codons and each codon is made up of three nucleotide bases. How might an extra single base INSERTION into the second codon of a coding sequence of a gene affect the amino acid sequence of the protein encoded by the gene? (Hint: You may want to write out a made-up example of an insertion like the one described above) The entire amino acid sequence would shift and be changed. O A single amino acid would change only. O The mutation may have no effect on the amino acid sequence. O A single extra amino acid would be present in the protein. O All of the above are possible outcomes.arrow_forwardA small section of mRNA codons has the following sequence:UGG GAA ACC UUC Some Amino Acids Aspartate Glutamate Glutamine Isoleucine Threonine Methionine Asparagine Tryptophan Phenylalanine The amino acids listed above that are coded by the mRNA codons are Answer, Answer, Answer, and Answer.Record your answer in order from left to right codons.arrow_forward
- All of the following are true about translation EXCEPT _____. as the ribosome moves from codon to codon, amino acids brought by successive tRNAs to the ribosome form a growing polypeptide when the ribosome reaches a stop codon, its subunits detach, and the mRNA and new polypeptide are released RNA polymerase assembles a strand of mRNA complementary to the coding strand of DNA Ribosomal subunits and a tRNA-carrying methionine converge on the start codon of an mRNAarrow_forwardDuring translation, the _________ of tRNA binds to the __________ of mRNA and _____________is added to the growing polypeptide.arrow_forwardTranslation is the process by which the sets of 3 bases (codons) of the mRNA are read to specify the sequence of amino acids for the protein to be produced. Using the genetic code data provided, find the sequence of amino acids that would correspond to the MRNA codons shown. Codons 1 3 MRNA A UGUGGAUC CGAG UCACG Amino acid SECOND LETTER A U UUU Phenylalanine UCU UCC Serine (S) UAU Tyrosine (Y) UAC TAA stop codon UAG stop codon UGU Cysteine (C) UGC TỮA Leucine (L) TGA stop codon UGG Tryptophan (W) F UCA UUG UCG I H CUU CCU CAU Histidine (H) R CGU CỨC Leucine (L) CỦA CCC Proline (P) ССА CCG CGC Arginine (R) CGA CAC "CAA Glutamine CAG (Q CUG CGG G D A AUU L AUC Isoleucine (1) AAU Asparagine AAC (N) ÄÄÄ Lysine (K) AGU Senine (S) ACU ACC Threonine ACA (T) AGC E AUA AGA Arginine (R) E ACG T AUG stat codon (M) AAG AGG TG GƯỮ GAU Apartic acid GAC (D) "GAÄ Glutamic acid GCU GGU GUC Valine (V) GUA GGC Glycine (0) GCC Alanine (A) CE GCA GGA R GUG GCG GGG GAG (E) The start codonencodes the amino…arrow_forward
- When examining the genetic code, it is apparent that ________. there are 44 stop codons because there are only 20 amino acids there can be more than one codon for a particular amino acid AUG is a terminating codon the code is ambiguous in that the same codon can code for two or more amino acids there can be more than one amino acid for a particular codonarrow_forwardBelow is the sequence of an mRNA that has just been transcribed. Please translate this sequence as if you were a ribosome, and write out the translation results. A genetic code table has been provided. mRNA: 5'- A C G U C C A A U G G C A G U G A U U U G A A U C C A -3'arrow_forwardAn anticodon of tRNA has the sequence GCA. What amino acid does this tRNA carry? HINT: you use mRNA codons to read the genetic code chart.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license