Pearson eText Biology: Life on Earth with Physiology -- Instant Access (Pearson+)
12th Edition
ISBN: 9780135755785
Author: Gerald Audesirk, Teresa Audesirk
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 13, Problem 1AC
Summary Introduction
To determine: Whether the gene would be longer, the mRNA be longer, or both be the same size when an mRNA molecule ready for translation is compared with that of section of the DNA from which the mRNA is transcribed.
Introduction: Some of the genes in a cell are transcribed into RNA and they express themselves in the form of proteins. After transcription, primary transcript is formed. There are four types of RNA, each playing its role during transcription and translation.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
In cells, proteins are synthesized from a gene sequence via the process of transcription and translation. Which of the following complementary base pairings would you observe during the synthesis (the making) of a prokaryotic protein? [I am looking for the complementary base pairing(s) you would see as you go from a gene to a protein. Note that it is prokarryotic protein and not eukaryotic protein].
DNA with mRNA
mRNA with tRNA
mRNA with rRNA
rRNA with tRNA
A.
1, 2 and 3
B.
1 and 3
C.
2 and 4
D.
4 only
E. All of 1, 2, 3 and 4 are correct
Students are modeling MRNA during the process of protein synthesis. Which answer choice correctly describes the model of the MRNA strand being
transcribed?
The MRNA strand is complimentary to the DNA template strand; however, uracil instead of adenine is paired with thymine.
O The MRNA strand is complimentary to the DNA template strand; however, uracil instead of thymine is paired with adenine.
O The MRNA strand is an exact copy the DNA template strand; however, uracil instead of adenine is paired with thymine.
The MRNA strand is an exact copy the DNA template strand; however, uracil instead of thymine is paired with adenine.
a
|理
2 Type here to search
Given the following sequence of nucleotides of a template DNA strand, predict the
sequence of mRNA that is transcribed from it. What is the nucleotide sequence of the
complementary strand of the DNA molecule? How does it differ from the nucleotide
sequence of RNA? DNA nucleotide sequence: CGTACGCCGAGACGTCAAC
Chapter 13 Solutions
Pearson eText Biology: Life on Earth with Physiology -- Instant Access (Pearson+)
Ch. 13.1 - describe three types of RNA that play roles in...Ch. 13.1 - Prob. 2CYLCh. 13.1 - Prob. 3CYLCh. 13.2 - Prob. 1TCCh. 13.2 - Prob. 1CYLCh. 13.2 - Prob. 2CYLCh. 13.2 - describe an example of post-transcription...Ch. 13.3 - Prob. 1TCCh. 13.3 - Prob. 1CSCCh. 13.3 - Prob. 1CYL
Ch. 13.3 - Prob. 2CYLCh. 13.3 - Prob. 3CYLCh. 13.3 - Prob. 4CYLCh. 13.4 - Prob. 1CSCCh. 13.4 - describe three different types of mutations?Ch. 13.4 - Prob. 2CYLCh. 13.5 - Prob. 1HYEWCh. 13.5 - Envision yourself as a physician. A mother,...Ch. 13.5 - Prob. 2TCCh. 13.5 - Prob. 1CYLCh. 13.5 - Prob. 2CYLCh. 13.5 - Prob. 3CYLCh. 13.5 - Prob. 4CYLCh. 13.5 - Prob. 1CTCh. 13 - Prob. 1MCCh. 13 - Which of the following is not true of RNA? a. It...Ch. 13 - Prob. 3MCCh. 13 - Prob. 4MCCh. 13 - Prob. 5MCCh. 13 - Synthesis of RNA from the instructions in DNA is...Ch. 13 - Prob. 2FIBCh. 13 - Prob. 3FIBCh. 13 - Prob. 4FIBCh. 13 - Prob. 5FIBCh. 13 - If a nucleotide is replaced by a different...Ch. 13 - Prob. 1RQCh. 13 - Name the three types of RNA that are essential to...Ch. 13 - Prob. 3RQCh. 13 - Prob. 4RQCh. 13 - Prob. 5RQCh. 13 - Prob. 6RQCh. 13 - Prob. 7RQCh. 13 - Define mutation. Describe four different effects...Ch. 13 - Prob. 1ACCh. 13 - Prob. 2AC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Diagram generally how a mRNA that contains sequences corresponding to four (4) exons would be translated. How many domains would the protein that results from translation contain?arrow_forwardWhat would be the mRNA strand if the DNA strand reads: T A C C G A G T C A C G?arrow_forwardOccurring in the nucleus ribosome mitochondrion , translation transcription is the process of making an RNA copy from a DNA template. The molecule then enters the cytoplasm. The process in which the mRNA sequence is converted into a sequence of amino acids is called translation transcription . In the cytoplasm, the nucleus ribosome mitochondrion reads the amino acid sequence and assembles the protein.arrow_forward
- The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGGGATAAACTC The left end of this molecule is the end. How many amino acids will be in the protein translated from this sequence? What is the name (not abbreviation) of the fourth amino acid in the protein translated from this sequence? The label on the end of the protein that is translated first is the + Jend.arrow_forwardWhat would be the mRNA strand if the DNA strand reads: TACCGAGTCACG?arrow_forwardSuppose that a DNA segment has the following nucleotide sequence: CTC ATA CGA TTC AAG TTA. Which of the following nucleotide sequences would be found in a complementary mRNA strand? (a) GAG UAU GAU AAC UUG AAU. (b) GAG TAT GCT AAG TTC AAT. (c) GAG UAU GCU AAG UUC AAU. (d) GUG UAU GGA UUG AAC GGU.arrow_forward
- Describe the steps (Initiation, Elongation and Termination) involved in translation of mRNA to generate a protein, including the all the important molecules involved and how they interact. Diagrams MUST be included in your answer. (Draw on some paper, then photograph and insert the drawing below.) You may add to your answer using bullet points if you find it easier, but make sure they are in the correct order!arrow_forwardGiven the following DNA sequence of the template (i.e. noncoding) strand for a given gene: 5'ATTGGCTGTTAGAGCGGCCGTCTAAACATCGTTGGA3' Part A) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) Part B) Use the genetic code to write the peptide sequence translated in a cell from the mRNA synthesized in part A. Please use the 3 letter abbreviation for each amino acid.arrow_forwardA strand of DNA contains this nucleotide sequence: TACTGCCTCCCCATAAGAATT. The corresponding nucleotide sequence of the mRNA strand from this DNA template is as follows: AUGACGGAGGGGUAUUCUUAA. Q: What is the amino acid sequence of the polypeptide that is produced form the mRNA strand? As well, draw a labelled diagram of the mRNA molecule being transcribed from this strand of DNA.arrow_forward
- in lecture we learned that translation is the process of what happens when a strand of RNA is translated into protein with the use of genetic information from RNA. i understand that the process is very different from eukaryotes and prokaryotes. My question is what would happen if the processes were switched? like the process for eukaryotes was now for prokaryotes and vice versa. Would it work but just not be as efficient or not work at all?arrow_forwardSuppose you are provided with a sequence of nucleotides. How would you determine if the sequence is of mRNA, tRNA, or DNA molecules?arrow_forwardWhat is the name of the enzyme is responsible for transcribing the DNA sequence into mRNA? In your own words, explain what this enzyme does.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY