Explain why the genetic code is said to be redundant and virtually universal? How these features may reflect its evolutionary history?

Q: What is meant by “Universality and Degeneracy” of the Genetic Code? What is the significance of the…

A: DNA have four bases, A, T, G and C, and proteins are made up of 20 different amino acids. Thereby…

Q: Define exon shuffling and explain why its occurrence might be an evolutionary advantage.

A: Gene expression is the process by which the instructions in the DNA are converted into a functional…

Q: Distinguish between homologs, paralogs, and orthologs.

A: Homologs can be used to predict the functions of unknown proteins that can be understood from the…

Q: Explain why there is redundancy in the genetic code but no ambiguity.

A: Redundancy: One amino acid is coded by more than one triplet codon. Ambiguity: One triplet codon…

Q: Compare and contrast the roles of introns and exons.

A: Introduction  A genome is consists of transcriptionally active genes. These genes form mRNA as they…

Q: Propose an evolutionary explanation for introns. Why might they have evolved?

A: The mutations are the permanent alterations in the genetic constitution of an organism. The…

Q: Describe the properties of the genetic code - how many codins code for amino acids, stop colons,…

A: The genetic code can be defined as a set of specific rules for a living cell to translate…

Q: What molecules are largely responsible for the universal feature of the genetic code?…

A: DNA is the store house of genetic information. This genetic information is expressed in the form of…

Q: Imagine if there were 200 commonly occurring amino acids instead of 20. Given what you know about…

A: Introduction: 20 amino acids make up all the proteins. These are the building blocks of proteins…

Q: Genome size varies considerably among multicellular organisms. Is this variation closely related to…

A: Genes contain sequences of nucleotides which are present on chromosomes. Genome complexity consists…

Q: Explain how the genetic code is both degenerate and redundant

A: Genetic code is a type of code which when translated makes the genes produce proteins  It helps to…

Q: Explain the central dogma of molecular biology

A: According to guidelines we have to answer the first question only. So, please kindly post the…

Q: What is the rationale for the hypothesis of the genetic code

A: The genetic code is a set of rules that living cells use to convert information encoded in genetic…

Q: Define Universal code  as they apply to the genetic code

A: Genetic code is universal. If AUG specifies methionine in monkey it also specify the same amino acid…

Q: do introns or 3′ untranslated regions of a gene have higher rates of nucleotide substitution?…

A: Introns are the regions that include non-coding regions of the RNA transcript. The introns are…

Q: explain what is Discoveries of the Genetic Code

A: The amino acid sequence of proteins is determined by the sequence of nucleotides in deoxyribonucleic…

Q: How did the genetic code originate?

A: Genetic code includes three letters of nucleotides that code for a particular amino acid.

Q: Explain the importance of the reading frame of a proteincoding gene

A: A gene is an area of DNA molecule or polymer of amino acid that encodes function. A chromosome…

Q: The human genome has 3.3 billion bases, of which 3% codes for protein. If a codon were four letters…

A: In most organisms, genetic information is stored in the form of the nucleotide sequence of DNA. This…

Q: Do you think that the alternate splicing of exons may enable a structural gene to code for several…

A: Alternative splicing is a basic regulatory process of gene expression. This process is very…

Q: Explain the importance of exonuclease ?

A: Enzymes are proteins that aid in the speeding up of the bodies' metabolism, or chemical reactions.…

Q: Explain why orthologs have sequences that are similar but not identical.

A: A homologous trait can be described as a homolog also spelled homologue. In terms of genetics, the…

Q: Explain Exceptional genetic codes?

A: A genetic code translates the genetic information encoded within the deoxyribonucleic acid (DNA) or…

Q: EXPLAIN The Genetic Code Is Almost,but Not Quite, Universal?

A:

Q: many more mRNA transcripts than there are genes. Why isn’t the number the same?

A: Regulatory protein (or gene-regulatory protein) is any protein that controls the transcription.…

Q: Explain what is meant by stating that the genetic code is triplet and nonoverlapping? What did the…

A: The genetic code may be defined as the exact sequence of DNA nucleotides read as three letter words…

Q: Explain why the genetic code is redundant

A: Introduction :- The genetic code is made up of codons, which are three-letter nucleotide pairings…

Q: Name one step of gene expression and describe one way that step differs between prokaryotes and…

A: The step of the gene expression is transcription. During this process the DNA sequence of a gene is…

Q: Describe in detail the term gene .

A: The hereditary components are what make up the gene. Alleles, which are tiny genetic building blocks…

Q: Explain the Conservation of the genetic code

A: Genetic code is the set of rules by which the genetic information is translated into proteins…

Q: Explain why the genetic code is said to be redundant and virtually universal, and discuss how these…

A: The flow of genetic information from DNA to proteins occurs via mRNA.

Q: What is the survival value of the degeneracy of the genetic code? – Define what degeneracy means and…

A: Introduction :- The genetic code is made up of codons, which are three-letter nucleotide pairings…

Q: can you explain Discoveries of the Genetic Code

A: The existance of a triplet code was simply an assumption till Nirenburg ( Nobel Prize winner) and…

Q: The genetic code is a complete, unabridged dictionaryequating the four-letter language of the…

A: Genetic code is the set of rules, encoded in genes for translation of proteins in living cells. The…

Q: Name some subtopics for introns and exons.

A: INTRODUCTION Introns and exons are nucleotide sequences within a gene. Introns are removed by RNA…

Q: Discuss evidence that the genetic code is almostuniversal, and cite some exceptions.

A: Genetic code is defined as a set of rules that decodes the information from DNA into a protein. A…

Q: A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′What topic in…

A: Answer: Introduction: RNA molecule consists of four nucleotide bases these are adenine (A), cytosine…

Q: One remarkable feature of the genetic code is that amino acids with similar chemical properties…

A: Introduction :- The genetic code is made up of codons, which are three-letter nucleotide pairings…

Q: explain about the Exceptional genetic codes

A: A set of rules that the cell uses to translate the mRNA into proteins is known as a genetic code.…

Q: Explain how the wobble hypothesis enables organisms to encode fewer tRNA molecules

A: As per Wobble hypothesis, more than one codon (base triplet) can code for a amino acid. It means…

Q: Define Overlapping code as they apply to the genetic code

A: A genetic code translates the genetic information encoded within the deoxyribonucleic acid (DNA) or…

Genetic Evolution

Sexual reproduction produces distinct population variations. Heredity determines the traits and qualities to be passed down to the progeny. Over time, this variation within-species is also affected by the process of human evolution. The study of how genetic variation leads to evolutionary changes is known as genetic evolution. If a trait helps an organism to survive and reproduce, it is more likely to be passed down the generations. It is rare that such traits result in a completely distinct set of traits in descendants than the ancestral population; this can result in the emergence of a new species.