To determine: The inference from the given experiment.
Introduction: In 1962, F. Chapeville and others reported an experiment in which they isolated radioactive C14-cysteinyl-tRNACys. They further removed the sulfur group from the cysteine and created alanyl-tRNACys. When alanyl-tRNACys was added to a synthetic mRNA, a polypeptide chain was synthesized containing alanine.
Explanation of Solution
As per the given information, a polypeptide chain was synthesized containing alanine. This occurred after adding radioactively labeled alanyl-tRNACys to a synthetic mRNA. From the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.
Thus, from the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.
Want to see more full solutions like this?
Chapter 14 Solutions
Concepts Of Genetics; Mastering Genetics With Pearson Etext -- Valuepack Access Card -- For Concepts Of Genetics; Student's Handbook And Solutions Manual For Concepts Of Genetics (11th Edition)
- Human wildtype and mutant alleles are identical in sequence except for a single base-pair substitution that changes one nucleotide towards the end of intron 2. The wildtype and mutant sequences of the affected portion of the mRNA are listed in the following table. Â Â Explain how a single base substitution could alter the reading frame, which could result in a physiological disorder?arrow_forwardThe following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3' A. How many amino acids long will be the protein translated from the only reading frame available in this segment? B. If a mutation changes the third letter of the stop codon in the only reading frame available in this segment, how many amino acids long will be the protein translated?arrow_forwardThe wobble rules for tRNA-mRNA pairing are shown. If we assume that the tRNAs do not containmodified bases, what is the minimum number of tRNAs needed to recognize the codons for the following types of amino acids? A. Leucine B. Methionine C. Serinearrow_forward
- Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.arrow_forwardA synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the following amino acid sequence: Met-ProIle-Ser-Ala. What would be the effect on translation if the following component were omitted from the cell-free protein-synthesizing system? What, if any, type of protein would be produced? Explain your reasoning. Q.Release factors RF-1, RF-2, and RF-3arrow_forwardThe hypothetical mRNA sequence below contains the coding region for a short peptide. What consequence for this peptide does the substitution of the uracil at position 28 of the mRNA with guanine have? GGUUGAAUGGAACAACGCGUGCACCCUUAGAGGUAACCCUCC                          |              G  Group of answer choices No consequence, it is a silent mutation. It shortens the peptide by two amino acids. It destroys the start codon of the peptide coding region. It extends the peptide by two amino acid. It replaces one of the original amino acids of the protein with a different one.arrow_forward
- What polypeptide sequences would you expect to result from a synthetic mRNA with the repeating sequence 5’-UUUGGGUUUGGGUUUGGG-3'?arrow_forwardConsider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?arrow_forwardYou start by looking at the mutations that Yanofsky recovered in TrpA. One of these mutations affected amino acid number 177 and changed it from Leucine to Arginine – because Yanofsky recovered it in his screen, that means that having an Arginine in this position does not allow the TrpA gene to function properly. Assuming that this particular mutation induced by Yanofsky was a single nucleotide change, what are the possible codons of Leucine that could be found at this position in wild-type TrpA? What are the possible codons for Leucine that could be found in the mutant?. If you took this mutant E. Coli line (that has an Arginine at this location) and exposed it to a mutagen that could potentially change bases, what are the second mutations you would most likely discover that would restore the activity of the tryptophan synthetase gene and where would it be located?arrow_forward
- You start by looking at the mutations that Yanofsky recovered in TrpA. One of these mutations affected amino acid number 177 and changed it from Leucine to Arginine – because Yanofsky recovered it in his screen, that means that having an Arginine in this position does not allow the TrpA gene to function properly. Assuming that this particular mutation induced by Yanofsky was a single nucleotide change, what are the possible codons of Leucine that could be found at this position in wild-type TrpA? What are the possible codons for Leucine that could be found in the mutant?arrow_forwardTwo missense mutations in the gene that encodes an enzyme called superoxide dismutase cause a form of amyotrophic lateral sclerosis (ALS, or Lou Gehrig disease). This disease causes loss of neurological function over a 5-year period. One mutation alters the amino acid asparagine (Asn) to lysine (Lys). The other changes an isoleucine (Ile) to a threonine (Thr). List the codons involved and describe how single-base mutations can alter the specified amino acids.arrow_forwardA mutant strain of Salmonella bacteria carries a mutation of the rho protein that has fully activity at 37°C but is completely inactivated when the mutant strain is grown at 40°C. a)Speculate about the kind of differences you would expect to see if you compared a broad spectrum of mRNAs from the mutant strain grown at 37°C and the same spectrum of mRNAs from the strain when grown at 40°C. b)Are all the mRNAs affected by the rho protein mutation in the same way? Why or why not?arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning