![Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)](https://www.bartleby.com/isbn_cover_images/9780135564172/9780135564172_largeCoverImage.gif)
Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
3rd Edition
ISBN: 9780135564172
Author: Mark Sanders, John Bowman
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 14, Problem 22P
Given your knowledge of the genetic tools for studying Drosophila, outline a method by which you could clone the dunce and rutabaga genes identified by Seymour Benzer’s laboratory in the genetic screen described at the beginning of this chapter.
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
From your knowledge about DNA microarray, answer the following:
A- How DNA microarray is created? and why it is referred to as “hybridization technology”?
B- Why RT-PCR is important in the sample preparation to perform expression microarray experiment?
C- Mention the name and the color of the dyes used in expression microarray?
D- If the expression microarray experiment was done with a normal sample and a suspected sample, after reading the color pattern resulted from the experiment it was recorded that “gene A22” is expressed in the suspected sample. The gene A22 is clinically linked to colon cancer. Answer the following: What is the expected color of the spot on the microarray which represents this gene? What is your interpretation of the suspected sample; is it a cancer sample or not and explain why?
Transcriptome analysis involves two separate methodologies: gene expression and RNA seq analyses. The 10 items below are a scrambled listing of the steps used in the two procedures. Identify the steps involved in RNA seq from the list below. Use the numbers in the list to refer to each step. Once the steps for RNA seq have been identified, write the steps in the order in which they are performed during the experiment.
(1) DNA sequencing
(2) Allow for hybridization and wash excess cRNA.
(3) Mix labeled cRNA with array chip.
(4) PCR amplification
(5) Measure fluorescence intensity to determine abundance of transcripts.
(6) Add labeled cRNA at each microarray location.
(7) Map cDNA sequences to the genome of the organism to determine identity and abundance of transcripts.
(8) mRNA isolation from cells
(9) Prepare fluorescently labeled cRNA probes
(10) cDNA synthesis
If you wanted to analyze the size and abundance of the HOAP protein in an extract from a Drosophila animal that you think may be mutant for the HOAP gene, what method could you use to target your analysis specifically to the HOAP protein in that extract?
Chapter 14 Solutions
Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
Ch. 14 - 14.1 What are the advantages and disadvantages of...Ch. 14 - Prob. 2PCh. 14 - Discuss the similarities and differences between...Ch. 14 - 14.5 What are the advantages and disadvantages of...Ch. 14 - 14.6 You have cloned the mouse ortholog (see...Ch. 14 - 14.7 Diagram the mechanism by which CRISPRCas...Ch. 14 - 14.8 Describe how CRISPRCas has been modified to...Ch. 14 - 14.9 Discuss the advantages (and possible...Ch. 14 - 14.10 Discuss the advantages (and possible...Ch. 14 - You have identifies a gene encoding the protein...
Ch. 14 - You have identified a recessive mutation that...Ch. 14 - 14.13 The CBF genes of Arabidopsis are induced by...Ch. 14 - 14.14 When the S. cerevisiae genome was sequenced,...Ch. 14 - 14.15 Translational fusions between a protein of...Ch. 14 - 14.16 In humans, Duchenne’s muscular dystrophy is...Ch. 14 - 14.17 How would you perform a genetic screen to...Ch. 14 - In enhancer trapping experiments, a minimal...Ch. 14 - 14.19 In Genetic Analysis, we designed a screen to...Ch. 14 - How would you design a genetic screen to find...Ch. 14 - 14.21 The eyes of Drosophila develop from imaginal...Ch. 14 - 14.22 Given your knowledge of the genetic tools...Ch. 14 - Mutations in the CFTR gene result in cystic...Ch. 14 - 14.24 How would you clone a gene that you have...Ch. 14 - 14.25 How would you conduct a screen to identify...Ch. 14 - In land plants, there is an alternation of...Ch. 14 - 14.27 The Drosophila evenskipped (eve) gene is...Ch. 14 - Prob. 28PCh. 14 - 14.29 As shown in Figure, mutations in the...Ch. 14 - How would you edit a specific nucleotide in a...Ch. 14 - Through a forward genetics screen in Arabidopsis...Ch. 14 - The CRISPR - Cas 9 complex directs the Cas 9...Ch. 14 - 14.33 Describe how enhancer screens can be used to...Ch. 14 - How might you use CRISPR - Cas 9 to create a large...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- If you wanted to make a mouse model for any of the following human genetic conditions (a–d), indicate which of thefollowing types of mice (i–vi) would be useful to your studies. If more than one answer applies, state which type ofmouse would most successfully mimic the human disease:(i) transgenic mouse overexpressing a normal mouse protein; (ii) transgenic mouse expressing normal amounts of amutant human protein; (iii) transgenic mouse expressing adominant negative form of a protein; (iv) a knockout mouse;(v) a conditional knockout mouse; and (vi) a knockin mousein which the normal allele is replaced with a mutant allelethat is at least partially functional. In all cases, the transgeneor the gene that is knocked out or knocked in is a form of thegene responsible for the disease in question.a. Marfan syndrome (a dominant disease caused byhaploinsufficiency for the FBN1 gene);b. A dominantly inherited autoinflammatory diseasecaused by a hypermorphic missense mutation in thegene PLCG2;c.…arrow_forwardTopic: Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting factors) Question Describe the molecular genetics process using proper scientific terminology. Describe the steps that are involved. How is it performed?arrow_forwardexplain the ethical concerns for this biotechnology method (sanger sequencing)arrow_forward
- Can you suggest how we could have determined whether Bill’s aunts were carriers of the mutant BTK gene? Give the name for the procedure and brief explanation of how it’s done and the anticipated results. What controls would be needed?arrow_forwardDiscuss three important advances that have resulted from gene cloning.arrow_forwardYou are asked to design PCR primers (18 nucleotides) to amplify the coding region (without the stop codon) of the following gene. Please write down the sequences of primers. (Indicate the 5' and 3' of the primers). 4. 5'atgaagaccaatagagagcaggaaatttacgttgaaagaagcttcaaaccaaacaattcaacaattcagaatttgatggacattgaaag gttcattttgcctcacacttctacatcaggtgtcgcaaggctcaaaatgagggtcatatcatgggtegggcttcagttctacaactactga-3’arrow_forward
- Not all inherited traits are determined by nuclear genes (i.e., genes located in the cell nucleus) that are expressed during the life of an individual. In particular, maternal effect genes and mitochondrial DNA are notable exceptions. With these ideas in mind, let’s consider the cloning of a sheep (e.g., Dolly). A. With regard to maternal effect genes, is the phenotype of such a cloned animal determined by the animal that donated the enucleatedegg or by the animal that donated the somatic cell nucleus? Explain.arrow_forwardYou just graduated from college and started working at a biotech startup called Scrofabulous. Your first job assignment is to clone the pig gene for the hormone prolactin. Assume that the pig gene for prolactin has not yet been isolated, sequenced, or mapped; What would be the most useful and economical first step to go about identifying and cloning the pig gene for prolactin? use the amino acid sequence of mouse prolactin to design a pair of degenerate oligonucleotide PCR primers to PCR-amplify the pig prolactin gene. RNAseq the pituitary gland of the pig, the most abundant gene is likely to to be prolactin Conduct a proteome search for peptides that match parts of mouse prolactin protein Sequence the pig genome, then translate the genome to find the gene predicted to encode for prolactin Crystalize the mouse prolactin protein and use Google's DeepMind Al to find the closest amino acid sequence in the pig proteomearrow_forwardAnswer each of the following questions correctly.(2-5 sentences only)(DO NOT USE THE EXAMPLE I PROVIDED FOR YOUR ANSWER( A. How cloning and expression of certain genes allows for massive production of the desired product.(Give an specific example, AGAIN PLEASE DO NOT USE THIS EXAMPLE AS YOUR EXAMPLE FOR MY QUESTION. YOU ARE NOT ALLOWED TO COPY AND PASTE MY EXAMPLE FOR YOUR ANSWER. PLEASE PROVIDE ANOTHER EXAMPLE .DO NOT USE MY EXAMPLE) For example: the cloning and expression of insulin in bacteria allows for the mass production of this necessary protein for use by diabetic patients.arrow_forward
- Question 1 a) Describe 2 approaches that you can use to determine that you have successfully PCR amplified Sonic Hedgehog. b) What are the key modifications to the PCR primers, SHFw1 and SHRv1 in order for you to clone the PCR amplified Sonic Hedgehog into the multiple cloning site (MCS) of pSELECT-CGFP-blasti. Explain your answer in detail c) After you have successfully cloned Sonic Hedgehog into pSELECT-CCFP-blasti and transfected HEK 293 cells (human embryogenic kidney cells), you observed, using confocal microscopy that the GFP fluorescence displays a reticulate network pattern in the cytoplasm of the cells. Describe an approach you can use to determine the subcellular localization of the Sonic Hedgehog-GFP fusion protein.arrow_forwardDescribe how you would use replica plating of mutagenized, haploid yeast cells to identify temperature-sensitive (ts) mutations in essential genes needed for yeast growth and survival.arrow_forwardTopic: Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting factors) Question What are the drawbacks/disadvantages/unknowns associated with this genetic process?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Case Studies In Health Information ManagementBiologyISBN:9781337676908Author:SCHNERINGPublisher:Cengage
Case Studies In Health Information Management
Biology
ISBN:9781337676908
Author:SCHNERING
Publisher:Cengage
Embryology | Fertilization, Cleavage, Blastulation; Author: Ninja Nerd;https://www.youtube.com/watch?v=8-KF0rnhKTU;License: Standard YouTube License, CC-BY