You just graduated from college and started working at a biotech startup called Scrofabulous. Your first job assignment is to clone the pig gene for the hormone prolactin. Assume that the pig gene for prolactin has not yet been isolated, sequenced, or mapped; What would be the most useful and economical first step to go about identifying and cloning the pig gene for prolactin? use the amino acid sequence of mouse prolactin to design a pair of degenerate oligonucleotide PCR primers to PCR-amplify the pig prolactin gene. RNAseq the pituitary gland of the pig, the most abundant gene is likely to to be prolactin Conduct a proteome search for peptides that match parts of mouse prolactin protein Sequence the pig genome, then translate the genome to find the gene predicted to encode for prolactin O Crystalize the mouse prolactin protein and use Google's DeepMind Al to find the closest amino acid sequence in the pig proteome

You just graduated from college and started working at a biotech startup called Scrofabulous. Your first job assignment is to clone the pig gene for the hormone prolactin. Assume that the pig gene for prolactin has not yet been isolated, sequenced, or mapped; What would be the most useful and economical first step to go about identifying and cloning the pig gene for prolactin? use the amino acid sequence of mouse prolactin to design a pair of degenerate oligonucleotide PCR primers to PCR-amplify the pig prolactin gene. RNAseq the pituitary gland of the pig, the most abundant gene is likely to to be prolactin Conduct a proteome search for peptides that match parts of mouse prolactin protein Sequence the pig genome, then translate the genome to find the gene predicted to encode for prolactin O Crystalize the mouse prolactin protein and use Google's DeepMind Al to find the closest amino acid sequence in the pig proteome

Name: You just graduated from college and started working at a biotech star
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: You just graduated from college and started working at a biotech startup called Scrofabulous. Yourfirst job assignment is to clone the pig gene for the hormone prolactin. Assume that the pig genefor prolactin has not yet been isolated, sequenced, or

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter14: Biotechnology And Society

Section: Chapter Questions

Problem 7QP

See similar textbooks

Similar questions

Here another DNA sequence that will amplify another gene known to confer the ability to taste additional bitter compound. You would like to perform a PCR to amplify this sequence. Which pair of primers was used to amplify this sequence? 5' TAGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTCTCTGCCGAATCAGTGGTCCCAAAGATGGA GTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACC 3' 5'-TAGAAAAGGAAGGTGGCT-3' and 5'-TTGAAGACGTGGTTGGAA-3' O 5'-AGCCACCTTCCTTTTCTA-3' and 5'-AACTTCTGCACCAACCTT-3' O 5'-TTGAAGACGTGGTTGGAA-3' and 5'-AGCCACCTTCCTTTTCTA-3' O 5'-TAGAAAAGGAAGGTGGCT-3' and 5'-AACTTCTGCACCAACCTT-3'
When doing a lab that involves Extraction of Genomic DNA from adult Drosophila melanogaster. - What are the controls you should use and why use these? What is special about the genomic DNA? What do you expect to find (using these genomic DNA samples)? please help!
If you knew the mRNA sequence for the human insulin gene could you know what size cDNA fragment you would find on your DNA gel when you ran it against a size standard (a “molecular ruler”)? Would you continue with your insulin cloning experiment, if the DNA from your PCR was very different in size from that predicted by the insulin mRNA? Why or why not? Primers can sometimes bind and target the wrong gene, especially if the primers are allowed to bind to the DNA strands at a low temperature. PCR also preferentially amplify short segments of DNA. Would it be important to actually run the cDNA after the PCR on a DNA gel in order to check for a PCR product of the predicted size for the insulin gene? Why or why not?
Which goals of the Human Genome Project do you think are themost important? Why? Discuss the types of ethical problems thatmight arise as a result of identifying all of our genes.
. Let’s say that you have incredible skill and can isolate the white and red patches of tissue from the Drosophila eyes shown in Figure 12-24 in order to isolate mRNA from each tissue preparation. Using your knowledge of DNA techniques from Chapter 10, design an experiment that would allow you to determine whether RNA is transcribed from the white gene in the red tissue or the whitetissue or both. If you need it, you have access to radioactive white-gene DNA
In contrast with the genomic manipulations of animals and plants described in this chapter, human genetherapy is directed specifically at altering the genomes of somatic cells rather than germ-line cells.Why couldn’t or wouldn’t medical scientists try to alter the genome of human germ-line cells?
You have isolated a transposable element from the human genome and have determined its DNA sequence.How would you use this sequence to determine thecopy number of the element in the human genome ifyou just had a computer with an Internet connection?
What would be your experimental strategy and the lab materials required to clone the complementary human gene using a mammalian gene in conjunction with PCR?
Your advisor, a brilliant bioinformatician, has high regard for your intellect and industry. she suggests that you write a computer program that will identify the exons of protein- coding genes directly from the sequence of the human genome. In preparation for that task, you decide to write down a list of the features that might distinguish protein- coding sequences from intronic DNA and from other sequences in the genome. What features would you list?
You’ve made your construct and placed it into E. coli! Congratulations, you have made a transgenic organism. Your investors will want to know about quality control. How will you check that the correct piece of DNA is in your vector? How will you check to make sure the gene is transcribed? How will you check to make sure that the GasP protein is made in E. coli? Your investors are concerned that the GasP protein might not be sufficiently produced under normal laboratory conditions. They suggest controlling the transcription of the gasP gene using a chemical that will “trigger” its transcription. What type of promoter could be used? What chemical will you use to control transcription? How does this method of control work?
Scientists are interested in cloning an extinct animal called the gastricbrooding frog. This strange frog swallows its eggs and broods itsyoung within its stomach. So far, scientists have successfully usedcloning to make an embryo of the frog, but they have yet to raise oneto maturity. What steps might the scientists have used to clone thisextinct species? Why was it important for scientists to determinebefore the experiments that the great barred frog is a close relative tothe gastric brooding frog?
Wooly Mammoths have been extinct for about 10,000 years; however, their remains have been well persevered in Siberia. Due to global warming, these remains are now available to be recovered. Scientists want to extract the DNA and through cloning insert the DNA into an elephant to clone the mammoth. What are some of the pros and cons of cloning an extinct animal?