To analyze:
The majority of organisms exhibit a circadian rhythm, a cycling of biological processes that are generally harmonized with day length (e.g., jet lag arises in humans when rapid movement between time zones causes established circadian rhythms to be out of synch with daylight hours). In Drosophila, pupae eclose (appear as adults after metamorphosis) at the time of dawn. Using this information,
Outline the screening method for Drosophila mutants that have an impaired circadian rhythm.
In majority of plants, such as Arabidopsis, genes whose encoded products have roles linked to photosynthesis have expression patterns that differ in a circadian manner. Using this information, outline the screening method for Arabidopsis mutants that have an impaired circadian rhythm.
Analyze the method for cloning of the genes that are identified by mutation.
Introduction:
A circadian rhythm is a natural process that is present in most living organisms. It is a biological process that regulates the wake-sleep cycle and repeats the cycle every
Want to see the full answer?
Check out a sample textbook solutionChapter 14 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
- Huntington disease (HD) is an inherited neurodegenerative disorder characterized by gradual, irreversible impairment of psychological, motor, and cognitive functions. Symptoms typically appear in middle age, but onset can occur at almost any age, and the course of the disease can range from 15 to 20 years. The molecular basis of HD is becoming better understood, and the genetic mutation has been traced to a gene that encodes a large protein of unknown function. In individuals who will not develop HD, a region of the gene that encodes the N-terminus of this protein has a sequence of CAG codons (for glutamine) repeated 6 to 39 times in succession. In individuals with adult-onset HD, this codon (3 nucleotides) is typically repeated 40 to 55 times In those with childhood-onset HD, it is repeated more than 70 times. *codon: refers to the 3 nucleotides that code for amino acid. A small portion of the coding sequence of the HD gene is given below. The nucleotide sequence of the DNA is…arrow_forwardWhat would be the most likely effect of inhibiting the translation of hunchback mRNA throughout a Drosophila embryo?arrow_forwardIn humans, dosage compensation is accomplished by: inactivating one X chromosome in female somatic cells inactivating one homolog from each homologous pair of chromosomes in female somatic cells inactivating the Y chromosome in male somatic cells increasing gene expression from the X chromosome in male somatic cellarrow_forward
- In a particular organism, there are two similar genes called YFG1 and YFG2. YFG1 is expressed in the liver and not in the pancreas, and YFG2 is expressed in the pancreas but not the liver. Neither YFG1 nor YFG2 is expressed in the heart. If you extract DNA from heart cells, do you expect to see the YFG2 gene? Explain why. Do you expect to see the YFG1 protein when you analyze protein extract from liver cells? And from pancreas cells? And from heart cells? Explain why. Is it possible to produce YFG1 and YFG2 proteins via alternative splicing? Explain one possible way (mechanism) to regulate the expression of YFG1 gene.arrow_forwardYou isolate a glp-1 mutation of C. elegans and discover that the DNA region encoding the spatial control region (SCR) has been deleted. What will the GLP-1 protein expression pattern be in a four-cell embryo in mutant heterozygotes? In mutant homozygotes?arrow_forwardAnother way to study the role of proteins (e.g., transcription factors) that function in development is to microinject the mRNA that encodes a protein, or the purified protein itself, into an oocyte or embryo, and then determine how this affects the subsequent development of the embryo, larva, and adult. For example, if Bicoid protein is injected into the posterior region of an oocyte, the resulting embryo will develop into a larva that has anterior structures at both ends. Based on your understanding of the function of each developmental gene, what would be the predicted phenotype if the following proteins or mRNAs were injected into normal oocytes? A. Nanos mRNA injected into the anterior end of an oocyte B. Antp protein injected into the posterior end of an embryo C. Toll mRNA injected into the dorsal side of an early embryoarrow_forward
- Explain why loss-of-function hedgehog and smoothened mutations yield the same phenotype in flies, but a loss-of- function patched mutation yields the opposite phenotype.arrow_forwardExpression of recombinant proteins in yeast is an important tool for biotechnology companies that produce new drugs for human use. In an attempt to get a new gene X expressed in yeast, a researcher has integrated gene X into the yeast genome near a telomere. Will this strategy result in good expression of gene X? Why or why not? Would the outcome of this experiment differ if the experiment had been performed in a yeast line containing mutations in the H3 or H4 histone tails?arrow_forwardWhat is the signaling pathway that mediates the organizing activity of the A/P organizer in the Drosophila wing disc? Describe two experiments that suggest this pathway functions to organize pattern and promote growth along the anterior/posterior axis of wing imaginal discs.arrow_forward
- Gene A, which encodes alcohol dehydrogenase, is labeled with a red fluorophore in a FISH experiment with one chromosome of a homologous pair, with results shown below. Gene B is labeled in green and encodes Notch2NL, a gene which may help to explain brain size differences between humans and chimpanzees, and which with increased dosage, may lead to a condition referred to as macrocephaly (enlarged head circumference sometimes associated with learning disabilities). What can you infer about these two genes given the results seen below?arrow_forwardBelow are the DNA sequences that encode the first eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that differ from the first sequence are shown by a lowercase letter. ATGTCTCTCACCAACAAGAACGTC ATGgCTCTCACCAACAAGAACGTC ATGTCgCTCACCAACAAGAACGTC ATGTCTtTgACCAACAAGAACGTC ATGTCTCTCACCAACAAGAACGTg a. What are the first eight amino acids for each of these five DNA sequences? b. For each of the five polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism. c.The fourth sequence shown above has two mutational differences from the first sequence. Specifically, the third codon is TTG versus CTC in the first sequence. These two codons are two mutational steps away from each other. Supposing that the CTC sequence gave rise to the TTG sequence, do you think it is more likely that the one-difference intermediate was TTC or CTG? d. In general, synonymous polymorphisms tend to be more common than nonsynonymous…arrow_forwardBased on standard MS- LS3-1: Fish in a cave system in Mexico is missing its eyes, has thin, translucent skin, and is relatively small (7-10 cm in length). Can you describe by model why structural changes to genes (mutations) on chromosomes may affect proteins and may result in beneficial effects to the structure and function of the fish? Can you answer in the following format? 1- Structure How Structure and Function is Affected by Mutations in Blind Fish Eyes Scales Taste Cells Lateral Line 2- Model to explain what causes these changes: Change: ______________ Adapting an Organism to the Dark Cause: ________________ Stop the Growth of Eyes Effect: ___________________ Fish with Heightened Other Senses References: Video: Rare Blind Cave Fish in Mexican Cave System https://www.youtube.com/watch?v=MWdtGuDd8z0 Fact Sheet: Blind Cave Fish https://www.denverzoo.org/animals/blind-cave-fish Information: Mexican Tetra…arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education