![EBK BIOLOGY](https://www.bartleby.com/isbn_cover_images/8220102797376/8220102797376_largeCoverImage.jpg)
EBK BIOLOGY
4th Edition
ISBN: 8220102797376
Author: BROOKER
Publisher: YUZU
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 14, Problem 2TY
Summary Introduction
Introduction: The open reading frame of mRNA helps in the synthesis of protein. The process of protein synthesis is known as translation and it takes place inside the cytoplasm of the cell. There is an involvement of a number of amino acids that forms the chains of polypeptides.
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Ribosomal RNA ____________________.
a. Carries amino acids to the ribosome
b. Carries information from the DNA to the ribosome
c. Helps make up the ribosome
d. Carries oxygen to cells
A mutation occurs that alters the third base in an mRNA codon from a C to a G. This mutation is most likely a
A.
frameshift mutation
B.
missense mutation
C.
nonsense mutation
D.
silent mutation
Regulation of gene expression most typically occurs at the level of ______________.
Select one:
a.
transcription
b.
post-transcription
c.
post-translation
Chapter 14 Solutions
EBK BIOLOGY
Ch. 14.1 - Consequences of Mutations Concept Check: Based on...Ch. 14.1 - Prob. 2CCCh. 14.1 - Prob. 3CCCh. 14.2 - Prob. 1EQCh. 14.2 - Prob. 2EQCh. 14.2 - Prob. 3EQCh. 14.2 - Prob. 1CCCh. 14.2 - Prob. 2CCCh. 14.3 - DNA Repair Concept Check: Which components of the...Ch. 14.3 - Why is this person so sensitive to sunlight?...
Ch. 14.4 - Prob. 1CCCh. 14.4 - Prob. 1BCCh. 14.4 - Prob. 2CCCh. 14.4 - Prob. 3CCCh. 14.4 - Prob. 4CCCh. 14 - Prob. 1TYCh. 14 - Prob. 2TYCh. 14 - Prob. 3TYCh. 14 - Prob. 4TYCh. 14 - Prob. 5TYCh. 14 - The Ames test a. provides a way to determine if...Ch. 14 - Xeroderma pigmentosum a. is a genetic disorder...Ch. 14 - Prob. 8TYCh. 14 - Prob. 9TYCh. 14 - Prob. 10TYCh. 14 - Prob. 1CQCh. 14 - Prob. 2CQCh. 14 - Prob. 3CQCh. 14 - Prob. 1COQCh. 14 - Distinguish between spontaneous and induced...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which of the following enzymes adds a new amino acid to the growing chain of a protein during protein synthesis? a. aminoacyl-tRNA synthetase b. peptidyl synthetase c. peptidyl transferase d. ribosomal synthetasearrow_forwardChoose the combination of answers that most accurately completes the statement. Which of these features is found in eukaryotes but not bacteria? a. polygene mRNAs c. stop codon b. intronsarrow_forwardWhich of the following mutations is NOT a point mutation? A. Missense mutation B. Insertion mutation C. Nonsense mutation D. Silent mutationarrow_forward
- A mutation caused by a base deamination or a tautomerization is called a a. silent mutation b. transition mutation c. nonsense mutation d. missense mutationarrow_forwardWhat is the correct amino acid sequence for the mRNA code AUGCCAGUAUGA answer choices A. Tyr-Gly-His B. Met-Pro-Val C. Met-Pro-Ala-Val D. Tyr-Gly-Arg-Hisarrow_forwardAn enzyme known as ___________________ attaches an amino acid to the_________________ of a tRNA, thereby producing_______________ . a. aminoacyl-tRNA synthetase, anticodon, a charged tRNA b. aminoacyl-tRNA synthetase, 3′ single-stranded region of the acceptor stem, a charged tRNA c. polynucleotide phosphorylase, anticodon, a charged tRNA d. polynucleotide phosphorylase, anticodon, an aminoacyl-tRNAarrow_forward
- Certain introns can self-excise from RNA. a. false b. truearrow_forward________ are encoded by a nucleotide triplet codon. a. Amino acids b. Chromosomes c. RNA strandsarrow_forwardwhich of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply a. Thread-like blood vessels in eyes b. Excessive bleeding c. Dwarfism d. UV light sensitivity e. sunburn f. Bruisesarrow_forward
- The main function of an mRNA molecule is to_______ . a. store heritable information b. carry a translatable message c. form peptide bonds between amino acidsarrow_forwardDuring translation, __________________. a. A cell divides to make 2 new cells b. A cell divides to make 4 new cells c. DNA is used as a template to create mRNA d. mRNA, rRNA, and tRNA work together to make proteinsarrow_forwardWhich of the following results in the same amino acid in its protein sequence? a. missense mutation b. sense mutation c. nonsense mutation d. antisense mutationarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY