CAMPBELL BIOLOGY IN FOCUS (LL)-W/MOD.MA
3rd Edition
ISBN: 9780135686065
Author: Urry
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 14, Problem 6TYU
Summary Introduction
Introduction:
The unit of genetic code, which has three
Again, new amino acid is carried by tRNA, which again binds to the complementary codon of mRNA. In this way, amino acids get linked to each other, forming the long chain of the polypeptides.
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
2) Create an MRNA strand based on the given DNA template strand:
TACTTCCTATTITCTTGTCA CCGCACT
3) Using the mRNA codon chart, determine the amino acid sequence for the MRNA
sequence determined in question 3.
4) Consider the following double-stranded DNA molecule:
Complementary Strand: ATGTGTAGTGCGAGTTGA
Template Strand:
TACACATCACGCTCAACT
a) What would be the amino acid sequence coded for by the template strand of the
DNA molecule above?
Answer the following whether it is TRUE or FALSE:
1. For each DNA segment 3'-ACCTGCCTACCCG-5' the sequence of the mRNA molecule synthesized is 5'-TGGACGGATGGGC-3'
2. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-ATGGCTCCATACATG-3'.
3. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-AUGGCUCCAUACAUG-3'.
4. The template strand is the strand of DNA used for RNA synthesis.
5. Transcription forms a messenger RNA molecule with a sequence that is identical to the DNA template from which it is prepared.
Given the following DNA sequence of the template strand for a given gene:
5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3'
Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends).
Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid.
Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?
Chapter 14 Solutions
CAMPBELL BIOLOGY IN FOCUS (LL)-W/MOD.MA
Ch. 14.1 - MAKE CONNECTIONS In a research article about...Ch. 14.1 - What polypeptide product would you expect from a...Ch. 14.1 - DRAW IT The template strand of a gene contains the...Ch. 14.2 - What is a promoter? Is it located at the upstream...Ch. 14.2 - What enables RNA polymerase to start transcribing...Ch. 14.2 - WHAT IF? Suppose X-rays caused a sequence change...Ch. 14.3 - Given that there are about 20,000 human genes, how...Ch. 14.3 - How is RNA splicing similar to how you would watch...Ch. 14.3 - WHAT IF? What would be the effect of treating...Ch. 14.4 - What two processes ensure that the correct amino...
Ch. 14.4 - Discuss the ways in which rRNA structure likely...Ch. 14.4 - Describe how a polypeptide to be secreted is...Ch. 14.4 - WHAT IF? DRAW IT Draw a tRNA with the anticodon...Ch. 14.5 - What happens when one nucleotide pair is lost from...Ch. 14.5 - Prob. 2CCCh. 14.5 - WHAT IF? DRAW IT The template strand of a gene...Ch. 14 - In eukaryotic cells, transcription cannot begin...Ch. 14 - Prob. 2TYUCh. 14 - The anticodon of a particular tRNA molecule is A....Ch. 14 - Prob. 4TYUCh. 14 - Which component is not directly involved in...Ch. 14 - Prob. 6TYUCh. 14 - Prob. 7TYUCh. 14 - Prob. 8TYUCh. 14 - Prob. 9TYUCh. 14 - SCIENTIFIC INQUIRY Knowing that the genetic code...Ch. 14 - Prob. 11TYUCh. 14 - FOCUS ON INFORMATION Evolution accounts for the...Ch. 14 - SYNTHESIZE YOUR KNOWLEDGE Some mutations result in...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this mRNA?d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?arrow_forwardThe template strand of a segment of double-helical DNA contains the sequence – 5’-CTT-AAC-ACC-CCT-GAC-TTC-GCG-CCG-CAT-3’ a. What is the base sequence of the complementary strand of DNA? Indicate the 5’ and the 3’ ends. b. What is the base sequence of the mRNA that can be transcribed from this template DNA strand? Indicate the 5’ and the 3’ ends. c. What amino acid sequence can be coded by the mRNA in (b) starting from the 5’ end (or the N terminal amino acid)?arrow_forward1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.arrow_forward
- Consider the following sequence of DNA: 3'-TTA CGG-5'What dipeptide is formed from this DNA after transcription and translation? b. If a mutation converts CGG to CGT in DNA, what dipeptide is formed? c. If a mutation converts CGG to CCG in DNA, what dipeptide is formed? d. If a mutation converts CGG to AGG in DNA, what dipeptide is formed?arrow_forwardGiven the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTAAGACCTGTCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a.arrow_forward8.) Answer the following questions regarding the following DNA sequence. 3'TACGGGGATAGCCGGCGAATTAAATAGCTGTC - 5" A.) What is the MRNA sequence that would result from transcription of this sequence? Assume that the DNA would be read from left to right. What is the amino acid sequence that would result from translation of B.) the MRNA resulting from the sequence? See Codon Table on next page. 20 C.) What is the anti-codon found on the tRNA that would deliver the amino acid for the first codon in the MRNA sequence? D.) If the fourth nucleotide in the DNA sequence were deleted due to a mutation during DNA replication, what would the resulting amino acid sequence be? What type of mutation is this? E.) What impact would the mutation in the DNA sequence in PART D have on the function of the protein produced from original sequence? Why?arrow_forward
- The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1) Find the sequence of the MRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the Tis substituted with A (count from 5' end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!arrow_forward(a) Write the complementary base sequence for the matching strand in the DNA section shown below:. 5' - ATGTTACTAGT C-3' (b) The following section of DNA is used to build an MRNA for a protein: 3'-AAG-CTT-CTC-5'. What is the corresponding mRNA sequence?arrow_forwardThe coding DNA strand of a gene has the following DNA sequence: 5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’ 1) Find the sequence of the mRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the T is substituted with A (count from 5’ end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!arrow_forward
- Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?arrow_forwardDNA Leading strand: 5' AAA ATA | CGC TTT| TTA ATT | AAC CCC GGG 3' A I B IC| D Exons: A, C, D Introns: B 1. What is the structure of hnRNA transcribed from this template? 2. What is the structure of the MRNA obtained by splicing the hnRNA? 3. What will be the polypeptide sequence to be synthesized using this mRNA?arrow_forwardWhich of the following statements below is incorrect? * A. the genetic code is overlapping B. the genetic code is universal C. degenerate codon specify the same amino acids D. the genetic code is triplet Which protein can break covalent bond? * A. Helicase B. Primase C. SSB D. DNA gyrase What is the complementary hnRNA base sequence produced from the DNA base sequence 5' C-T-A-T-A-C 3'? * A. 3' C-A-T-A-T-C 5' B. 3' G-A-T-A-T-G 5' C. 3' G-A-U-A- U-G 5' D. 3' C-U-A-U-A-G 5' Which of the following statements concerning the " cloverleaf" shape of tRNA molecules is correct? * A. four hairpin loops are present B. three hairpin loops and one open end are present C. two hairpin loops and two open ends are present…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY