![EBK CONCEPTS OF GENETICS](https://www.bartleby.com/isbn_cover_images/9780134818979/9780134818979_largeCoverImage.gif)
EBK CONCEPTS OF GENETICS
12th Edition
ISBN: 9780134818979
Author: Killian
Publisher: YUZU
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 14, Problem 9PDQ
To carry out its role, each transfer RNA requires at least four specific recognition sites that must be inherent in its tertiary structure. What are they?
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human β-globin gene (Shown in Figure 17.11) into bacterial cells, hoping the cells will express it and synthesize functional β-globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does β-globin made by a eukaryotic cell. Explain why.
GTP hydrolysis is used multiple times during the course of protein synthesis to advance the process forward, often irreversibly.
Provide an example of a GTP-regulated step and its associated GTP binding factor that regulates a step during
A) translation initiation, and also
B) one that is associated with the translation elongation phase.
The anticodon loop of one of the tRNA Gly molecules from Escherichia coli is as follows:
a) Identify the anticodon, reading from 3’ to 5’.
b) This tRNA recognizes a Gly codon. What is it? Write it from 5’ to 3’.
Chapter 14 Solutions
EBK CONCEPTS OF GENETICS
Ch. 14 - Prob. 1NSTCh. 14 - A series of mutations in the bacterium Salmonella...Ch. 14 - HbS results from the substitution of valine for...Ch. 14 - Given that a faulty ribosomal protein is the...Ch. 14 - A couple with a child affected with DBA undergoes...Ch. 14 - Prob. 3CSCh. 14 - HOW DO WE KNOW? In this chapter, we focused on the...Ch. 14 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 14 - Contrast the roles of tRNA and mRNA during...Ch. 14 - Francis Crick proposed the adaptor hypothesis for...
Ch. 14 - During translation, what molecule bears the codon?...Ch. 14 - The chain of eukaryotic hemoglobin is composed of...Ch. 14 - Assuming that each nucleotide in an mRNA is 0.34...Ch. 14 - Summarize the steps involved in charging tRNAs...Ch. 14 - To carry out its role, each transfer RNA requires...Ch. 14 - What are isoaccepting tRNAs? Assuming that there...Ch. 14 - When a codon in an mRNA with the sequence 5-UAA-3...Ch. 14 - Discuss the potential difficulties of designing a...Ch. 14 - Prob. 13PDQCh. 14 - Prob. 14PDQCh. 14 - The synthesis of flower pigments is known to be...Ch. 14 - The study of biochemical mutants in organisms such...Ch. 14 - Explain why the one-gene: one-enzyme concept is...Ch. 14 - Why is an alteration of electrophoretic mobility...Ch. 14 - Prob. 19PDQCh. 14 - Prob. 20PDQCh. 14 - Prob. 21PDQCh. 14 - Prob. 22PDQCh. 14 - Several amino acid substitutions in the and ...Ch. 14 - Define and compare the four levels of protein...Ch. 14 - What are the two common types of protein secondary...Ch. 14 - How do covalent disulfide bonds, hydrogen bonds...Ch. 14 - Prob. 27PDQCh. 14 - List three different types of posttranslational...Ch. 14 - Prob. 29PDQCh. 14 - How does an enzyme function? Why are enzymes...Ch. 14 - Prob. 31PDQCh. 14 - Three independently assorting genes (A, B, and C)...Ch. 14 - How would the results vary in cross (a) of Problem...Ch. 14 - Deep in a previously unexplored South American...Ch. 14 - Many antibiotics are effective as drugs to fight...Ch. 14 - The flow of genetic information from DNA to...Ch. 14 - Prob. 37ESP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In EUKARYOTIC translation, how does initiation of translation occur? a) What components of the mature mRNA are involved (2 components) and b) what proteins are involved (at least 2 proteins)?arrow_forward1) Considering how readily RNA folds to form a secondary structure, why isn’t it used to store genetic information rather than double-stranded DNA? Cite multiple reasons. 2) Do miRNA and siRNA both derive from the same source? Explain.arrow_forwardTRUE OR FALSE a) Primary amines and keto groups of the nitrogen bases are involved in base-pairing in double stranded DNA. b) The unique stem-loop structures of the transfer RNA helps the RNA perform its function of joining ribosomal proteins to form the sites for protein synthesis.arrow_forward
- Which RNA conformation favors translation—the form with the Shine-Dalgarno antisequestor or the form in which the Shine-Dalgarno sequence is within a stem-loop?arrow_forwardSome years ago, it was suggested that the function of the poly(A) tail on a eukaryotic message may be to "ticket" the message. That is, each time the message is used, one or more residues is removed, and the message is degraded after the tail is shortened below a critical length. Suggest an experiment to test this hypothesis.arrow_forwarda) what is the genetic code and explain the properties b) list the difference between eukaryotic and prokaryotic translation initiation c) explain the role E.coli translation elongation factors.arrow_forward
- Which of the following statements best describes the initiation of translation? A) The large and small ribosomal subunits scan the mRNA in the 3'–5' direction until the promoter is reached. B) A tRNA with the anticodon, AUG, enters the ribosomal complex and binds to the mRNA at the A site. C) The mRNA containing the start codon, AUG, sits at the P site and forms a complex with the corresponding tRNA, and the large and small ribosomal subunits. D) The mRNA attaches to the large ribosomal subunit and once the start codon reaches the A site, the tRNA binds and the small subunit completes the complex.arrow_forwardEach transfer RNA requires at least four specific recognition sitesthat must be inherent in its tertiary protein structure in order forit to carry out its role. What are these sites?arrow_forwardWhich of the following is a processing step that must happen to mRNA before it is translated? Choose all that apply. A) Addition of a poly-A tail B) Splicing out introns C) annealing into a double-stranded helix D) cleavage E) Addition of a 7-methlguanosine caparrow_forward
- The pioneer round of translation of an mRNA is very important to identify potentially dangerous mRNAs if per chance they possess aberrant in frame translational stop codons. Their detection leads to rapid degradation through the NMD pathway. What indications would the cell use to signal that an mRNA possesses an in frame stop following the pioneering read? Choose one. a) The mRNA has a shorter Poly A tail since it is not being efficiently translated b) If the cap binding protein is no longer associated with the cap it signals to the cell that the mRNA is no longer translatable. c) A stalled ribosomal complex on the mRNA is clearly detectable and since the translational machinery cannot initiate protein synthesis it is recognized as toxic and is degraded by the 26S proteasome. d) If the mRNA contains intron sequences then it is quickly recognized by the ribosomes as being abnornal and is degraded rapidly by the 26S proteasome. e) mRNA species that are still bound by key factors that…arrow_forwarda) The deacetylation of histones generally causes gene inactivation. True or false? b)During eukaryotic translation, the first contact between the ribosome and the mRNA is usually made when the small ribosomal subunit directly binds to the translational start site (Kozak sequence) on the mRNA. True or false? c)The termination of translation is carried out by a single tRNA molecule that recognizes all three stop codons. True or false? d) The deamination of cytosine, which produces uracil, is less likely to be repaired, compared to the deamination of 5-methylcytosine, which produces thymine.True or false? e)An HLH-bHLH heterodimer can bind DNA. True or false? F)Chromatin remodeling complexes posseses ATPase activity. True or false? g)Histone methylation generally causes gene inactivation. True or false? h) A pre-mRNA is cleaved downstream of its polyA signal before the transcription terminates. True or false? i) During X chromosome inactivation in female mammals, most genes are repressed…arrow_forwardIf an antisense RNA is designed to silence the following mRNA sequence, which of the following antisense oligos (a-d) could be used for this purpose? mRNA sequence: 5' UAGGACUAUUAAGGUACACCCAUU 3' O 5' AUCCUGAUAAUUCCAUGUAAAUAA 3' O 5' AAUGGGUGUACCUUAAUAGUCCUA 3' O 5' UAGGACUAUUAAGGUACACCCAUU 3' O 5' UUACCCACAUGGAAUUAUCAGGAU 3¹arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license