![EBK CONCEPTS OF GENETICS](https://www.bartleby.com/isbn_cover_images/9780134818979/9780134818979_largeCoverImage.gif)
Concept explainers
HbS results from the substitution of valine for glutamic acid at the number 6 position in the β chain of human hemoglobin. HbC is the result of a change at the same position in the β chain, but in this case lysine replaces glutamic acid. Return to the genetic code table (Figure 13.7) and determine whether single-
Hint: This problem asks you to consider the potential impact of several amino acid substitutions that result from mutations in one of the genes encoding one of the chains making up human hemoglobin. The key to its solution is to consider and compare the structure of the three amino acids (glutamic acid, lysine, and valine) and their net charge.
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Chapter 14 Solutions
EBK CONCEPTS OF GENETICS
- When the amino acid sequences of insulin isolated from different organisms were determined, differences were noted. For example, alanine was substituted for threonine, serine for glycine, and valine for isoleucine at corresponding positions in the protein. List the single-base changes that could occur in codons of the genetic code to produce these amino acid changes.arrow_forwardIn HbS, the human hemoglobin found in individuals with sickle-cell anemia, glutamic acid at position 6 in the beta chain is replaced by valine. Q.) Show that one of the glutamic acid codons can be converted to a valine codon by a single substitution mutation (i.e., by changing one letter in one codon).arrow_forwardChoose a pentapeptied composed of five different amino acids. List the five amino acids. Present the messenger RNA codons for the amino acids and the sequence of the nucleotids on the DNA that was originally coded for the pentapeptide.arrow_forward
- The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution mutations (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons.(a) How many total mutations are possible?(b) How many of these mutations are “silent,” in the sense that the mutantcodon is changed to another Arg codon?(c) How many of these mutations are conservative, in the sense that an Argcodon is changed to a functionally similar Lys codon?arrow_forwardUse the following DNA sequence, and write the resulting messenger RNA sequence TACTTTGAATGCGGCCGTATC?arrow_forwardThe genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?arrow_forward
- Sickle cell anemia is a widespread disease in many African countries and can be caused by a change in the amino acid sequence from glutamic acid to valine. A patient is diagnosed with the disease and a genetic fingerprint reveals the following DNA sequence for the gene: (a) (b) (c) (d) (e) Write down the mRNA sequence for the given DNA sense strand indicating the polarity. Derive the polypeptide from the mRNA molecule using the table of the genetic code (Table Q1 below) again indicating the polarity of the peptide chain. Indicate the position in the DNA molecule that could have caused the disease and write down all possible point mutations in the DNA sequence that could have caused it. [ The polypeptide chain is polymerized at the ribosomes using t-RNA molecules. Write down all possible t-RNA molecules with their anti-codons that are used to polymerize the amino acid VAL. Indicate the polarity. 3'-TAC TGA GCA AGA TTA CAT ACT-5' Explain what is meant by redundancy of the genetic code.…arrow_forwardLactose permease, a protein of E. coli, is composed of a single polypeptide that is 417 amino acids in length. By convention, the amino acids within a polypeptide are numbered from the aminoterminus to the carboxyl-terminus. Are the following questions about lactose permease true or false? A. Because the 64th amino acid is glycine and the 68th amino acid is aspartic acid, the codon for glycine, 64, is closer to the 3′ end of the mRNA than the codon for aspartic acid, 68. B. The mRNA that encodes lactose permease must be greater than 1241 nucleotides in length.arrow_forwardCystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which prevent ions from moving across cell membranes. Normally there are channel proteins that allow passage of the ions, but in patients with one kind of CF these proteins seem odd. Closer examination shows that these proteins display the correct amino acid sequence. However, they fail to do their job. A) Given that the primary structure of the protein is correct, what can you infer about the DNA sequence for the gene coding this protein on this patient, is there a mutation? Explain. B) Why is the primary structure insufficient to guarantee the proper function of the protein?arrow_forward
- An enzyme isolated from rat liver has 193 amino acids and is encoded by a 1440 base pair long gene. Explain the connection between the amino acid number of the enzyme and the number of nucleotide pairs in its gene.arrow_forwardConsider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’ A) Transcribe and translate this gene using the genetic code table. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. B) Now, our hypothetical gene has undergone a mutation. The mutant sequence is....3’ TAC-GAT-AGT-ACC-AAT-ATT 5’5’ ATG-CTA-TCA-TGG-TTA-TAA 3’ Transcribe and translate the mutant sequence. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. C) Indicate the type of mutation (nonsense, missense, silent, or frame shift) present. D) How severe of a consequence will this mutation likely be in terms of protein function (none, mild, moderate or severe)? Why?arrow_forwardRepresentations of sequencing chromatograms for variants of the a chain of human hemoglobin are shown here. Match each of the variants with the corresponding amino acid change. You can use the codon table to decode each amino acid sequence. For example, the first triplet encodes for Val. Normal Chongqing ddATP ddCTP ddGTP ddTTP Pro to Thr Gly to Asp Leu to Arg Karachi Swan River Answer Bank Ala to Pro Asp to Gly Pro to Ala Arg to Leu Asp to Asn Arg to Valarrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)