Biology
Biology
12th Edition
ISBN: 9781260494570
Author: Raven, Peter
Publisher: MCGRAW-HILL HIGHER EDUCATION
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 15, Problem 1S

a.

Summary Introduction

To predict:

The sequence of the mRNA .

Using the template strand of the DNA with the sequence

3'CGTTACCCGAGCCGTACGATTAGG5'

Introduction:

The sequence of the m-RNA, is copied from the DNA by the process transcription and the amino acid sequence from the m-RNA is formed by the process of translation. Both of these processes lead to gene expression in eukaryotes.

b.

Summary Introduction

To predict:

The amino acid sequence of the protein.

Using the template strand of the DNA with the sequence

3'CGTTACCCGAGCCGTACGATTAGG5'

Introduction:

The sequence of the m-RNA, is copied from the DNA by the process transcription and the amino acid sequence from the m-RNA is formed by the process of translation. Both of these processes lead to gene expression in eukaryotes.

Blurred answer
Students have asked these similar questions
Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B )  Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid.  Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?
Given the DNA sequence below:        5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’  Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)
The template strand of a segment of double-helical DNA contains the sequence – 5’-CTT-AAC-ACC-CCT-GAC-TTC-GCG-CCG-CAT-3’ a. What is the base sequence of the complementary strand of DNA? Indicate the 5’ and the 3’ ends. b. What is the base sequence of the mRNA that can be transcribed from this template DNA strand? Indicate the 5’ and the 3’ ends. c. What amino acid sequence can be coded by the mRNA in (b) starting from the 5’ end (or the N terminal amino acid)?

Chapter 15 Solutions

Biology

Ch. 15.4 - Prob. 2LOCh. 15.4 - Explain the differences between bacterial and...Ch. 15.5 - Prob. 1LOCh. 15.5 - Prob. 2LOCh. 15.5 - Prob. 3LOCh. 15.6 - Explain why the tRNA charging reaction is critical...Ch. 15.6 - Prob. 2LOCh. 15.7 - Prob. 1LOCh. 15.7 - Prob. 2LOCh. 15.7 - Compare translation on the RER and in the...Ch. 15.9 - Prob. 1LOCh. 15.9 - Explain the nature of triplet repeat expansion.Ch. 15.9 - Prob. 3LOCh. 15 - Prob. 1DACh. 15 - Prob. 2DACh. 15 - Prob. 1IQCh. 15 - Prob. 2IQCh. 15 - Prob. 3IQCh. 15 - The experiments with nutritional mutants in...Ch. 15 - What is the central dogma of molecular biology? a....Ch. 15 - In the genetic code, one codon a. consists of...Ch. 15 - Eukaryotic transcription differs from prokaryotic...Ch. 15 - An anticodon would be found on which of the...Ch. 15 - RNA polymerase binds to a ________ to initiate...Ch. 15 - During translation, the codon in mRNA is actually...Ch. 15 - You have mutants that all affect the same...Ch. 15 - The splicing process a. occurs in prokaryotes. b....Ch. 15 - The enzyme that forms peptide bonds is called...Ch. 15 - In comparing gene expression in prokaryotes and...Ch. 15 - The codon CCA could be mutated to produce a. a...Ch. 15 - An inversion will a. necessarily cause a mutant...Ch. 15 - What is the relationship between mutations and...Ch. 15 - Prob. 1SCh. 15 - Frameshift mutations often result in truncated...Ch. 15 - Describe how each of the following mutations will...Ch. 15 - There are a number of features that are unique 10...
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY