![Genetics: From Genes To Genomes (6th International Edition)](https://www.bartleby.com/isbn_cover_images/9781260041217/9781260041217_largeCoverImage.gif)
Genetics: From Genes To Genomes (6th International Edition)
6th Edition
ISBN: 9781260041217
Author: Leland Hartwell Dr., ? Michael L. Goldberg Professor Dr., ? Janice Fischer, ? Leroy Hood Dr.
Publisher: Mcgraw-Hill
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 15, Problem 6P
How do you know if the halibut you purchased at the supermarket is really halibut? To identify the source of a biological sample, scientists PCR amplify and then sequence a region of DNA known to vary between species. For animals, this DNA region is a 648–base pair portion of the mitochondrial cytochrome oxidase I gene. The sequence of this mtDNA region acts as a so-called DNA barcode because a database exists that contains the sequences of this mtDNA region that are unique for hundreds of thousands of animal species.
a. | Why do you think that a region of mitochondrial DNA is used for barcoding animals, as opposed to a region of nuclear genomic DNA? |
b. | A single pair of PCR primers can be used to barcode any species of fish. Explain how this is possible. |
c. | List criteria that scientists would have considered when determining which mitochondrial DNA sequence to use for barcoding animals. |
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
How do you know if the halibut you purchased at the supermarket is really halibut? To identify the source of a biological sample, scientists PCR amplify and then sequence a region of DNA known to vary between species. For animals, this DNA region is a 648-base pair portion of the mitochondrial cytochrome oxidase I gene. The sequence of this mtDNA region acts as a so-called DNA barcode because a database exists that contains the sequences of this mtDNA region that are unique for hundreds of thousands of animal species.
A) Why do you think that a region of mitochondrial DNA is used for barcoding animals, as opposed to a region of nuclear genomic DNA?
You have sequenced the genome of the bacterium Salmonella typhimurium and find a protein that is 100 percent identical to a protein in the bacterium Escherichia coli. When you compare nucleotide sequences of the S. typhimurium and E. coli genes, you find that their nucleotide sequences are only 87 percent identical. How would you interpret the observations? Please make sure to select ALL correct answer options.
Because genetic code is redundant, changes in the DNA nucleotide sequence can occur without change to its encoded protein.
Due to the flexibility in the third positions of most codons, the DNA sequence can accumulate changes without affecting protein structure.
Natural selection will eliminate many deleterious amino acid changes. This will reduce the rate of change in the amino acid sequence and lead to sequence conservation of the proteins.
Protein sequences are expected to evolve and…
You have sequenced the genome of the bacterium Salmonella typhimurium and find
a protein that is 100 percent identical to a protein in the bacterium Escherichia coli.
When you compare nucleotide sequences of the S. typhimurium and E. coli genes,
you find that their nucleotide sequences are only 87 percent identical. How would
you interpret the observations? Please make sure to select ALL correct answer
options.
Because genetic code is redundant, changes in the DNA nucleotide sequence
can occur without change to its encoded protein.
Due to the flexibility in the third positions of most codons, the DNA sequence
can accumulate changes without affecting protein structure.
Natural selection will eliminate many deleterious amino acid changes. This will
reduce the rate of change in the amino acid sequence and lead to sequence
conservation of the proteins.
Protein sequences are expected to evolve and diverge more slowly than the
genes that encode them.
Chapter 15 Solutions
Genetics: From Genes To Genomes (6th International Edition)
Ch. 15 - Match each numbered item with the most closely...Ch. 15 - Assuming human cells have on average 1000...Ch. 15 - Reverse translation is a term given to the process...Ch. 15 - The human nuclear genome encodes tRNAs with 32...Ch. 15 - The human mitochondrial genome includes no genes...Ch. 15 - How do you know if the halibut you purchased at...Ch. 15 - Is each of these statements true of chloroplast or...Ch. 15 - Suppose you are characterizing the DNA of a...Ch. 15 - An example of a gene-targeting DNA plasmid vector...Ch. 15 - Which of the following characteristics of...
Ch. 15 - The Saccharomyces cerevisiae nuclear gene ARG8...Ch. 15 - The so-called hypervariable regions HV1 and HV2 of...Ch. 15 - Suppose a new mutation arises in a mitochondrial...Ch. 15 - Describe at least two ways in which the...Ch. 15 - Why are severe mitochondrial or chloroplast gene...Ch. 15 - Suppose you are examining a newly found plant...Ch. 15 - A form of male sterility in corn is inherited...Ch. 15 - Plant breeders have long appreciated the...Ch. 15 - A mutant haploid strain of Saccharomyces...Ch. 15 - Prob. 20PCh. 15 - What characteristics in a human pedigree suggest a...Ch. 15 - The first person in the family represented by the...Ch. 15 - In 1988, neurologists in Australia reported the...Ch. 15 - If you were a genetic counselor and had a patient...Ch. 15 - Kearns-Sayre syndrome KSS, Pearson syndrome, and...Ch. 15 - Many clinically relevant mitochondrial diseases...Ch. 15 - Leigh syndrome is characterized by psychomotor...Ch. 15 - All mutations in mitochondrial genes ultimately...Ch. 15 - How could researchers have determined that the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- You have just created the world’s first genomic library from the African okapi, a relative of the giraffe. No genes from this genome have been previously isolated or described. You wish to isolate the gene encoding the oxygen-transporting protein b-globin from the okapi library. This gene has been isolated from humans, and its nucleotide sequence and amino acid sequence are available in databases. Using the information available about the human b-globin gene, what two strategies can you use to isolate this gene from the okapi library?arrow_forwardArabidopsis thaliana has among the smallest genomes in higher plants, with a haploid genome size of about 100 Mb. If this genome is digested with BbvCl, a restriction enzyme which cuts at the sequence CCTCAGC GGAGTCG 1. approximately how many DNA fragments would be produced? Assume the DNA has a random sequence with equal amounts of each base.arrow_forwardNucleosomes can be assembled onto defined DNA segments. When a particular 225-bp segment of human DNA was used to assemble nucleosomes and then incubated with micrococcal nuclease, which digests DNA that is not located within the nucleosome, uniform fragments 147 bp in length were generated. Subsequent digestion of these fragments with a restriction enzyme that cuts once within the original 225-bp sequence produced two well-defined bands at 37 bp and 110 bp. Why do you suppose two well-defined fragments were generated by restriction digestion, rather than a range of fragments of different sizes? How would you interpret this result?arrow_forward
- The image below shows the base cytosine and a methylated form of cytosine that occurs frequently in the human genome. Use your knowledge of DNA structure to answer the following question: a) Does methylation of cytosine affect its ability to base-pair with guanine? Explain b) Could methylation of cytosine affect the binding of a protein that interacts with a C-G base-pair in the major groove? Explain your answer.arrow_forwardYou have sequenced the genome of the bacterium Salmonella typhimurium, and you are using BLAST analysis to identify similarities within the S. typhimurium genome to known proteins. You find a protein that is 100 percent identical in the bacterium Escherichia coli. When you compare nucleotide sequences of the S. typhimurium and E. coli genes, you find that their nucleotide sequences are only 87 percent identical.a. Explain this observation.b. What do these observations tell you about the merits of nucleotide- versus protein-similarity searches in identifying related genes?arrow_forwardThe image below shows the base cytosine and a methylated form of cytosine that occurs frequently in the human genome. Use your knowledge of DNA structure to answer the following questions: a) Does methylation of cytosine affect its ability to base-pair with guanine? Explain your answer. b) Would methylation of cytosine affect the binding of a protein that interacts with a C-G base-pair in the major groove?arrow_forward
- The following are DNA sequences from two homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTA GTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do not begin and end at the same location. Try to line them up according to their homologous regions.arrow_forwardYou were tasked to conduct a population genetic survey of a diploid insect population. You obtained tissue samples from 20 individuals, ran a starch gel electrophoresis, and stained the gel for lactate dehydrogenase. Below is the result of your gel electrophoresis. You found that there are three alleles and you decided to call them F, M, and S for their fast, medium, and slow mobility on the gel. please explain this in deep. 1) What is the M allele frequency in this population? A) 0.05 b) 0.25 c) 0.30 d) 0.4 e) 0.5 2)Following up the previous question, what is the observed SS genotype frequency in this population? a) 0.1 b) 0.2 3) 0.3 4) 0.4 5) 0.5arrow_forwardThe human genome (3.4 Gb) would be 2.3 metres long if stretched linearly. In not more than 200 words, explain how a genome of this size is fit into a cell of minuscule proportions. You may add a diagram to your answer.arrow_forward
- Scientists have observed that individuals with LOW birthweight are MORE likely to become obese as teenagers. To study this observation in more depth, a scientist compared the methylation of the promoter region of the leptin gene in low birthweight (LBW) and normal birthweight (NBW) individuals by treating isolated DNA from these individuals with bisulfite and comparing the results to untreated DNA. The results are shown below. What conclusion can you draw? Untreated: ATTCGATTCGCGAA Treated NBW: ATTCGATTCGCGAA Treated LBW: ATTTGATTCGTGAA Scientists have observed that individuals with LOW birthweight are MORE likely to become obese as teenagers. To study this observation in more depth, a scientist compared the methylation of the promoter region of the leptin gene in low birthweight (LBW) and normal birthweight (NBW) individuals by treating isolated DNA from these individuals with bisulfite and comparing the results to untreated DNA. The results are shown below. What…arrow_forwardIt is possible to take the DNA of a gene from any source and place it on a chromosome in the nucleus of a yeast cell. When you take DNA of a human gene and put it into a yeast cell chromosome, the yeast cell can synthesize the human protein. However, when you remove the DNA for a gene normally present on yeast mitochondrial chromosomes and put it on a yeast chromosome in the nucleus, the yeast cell cannot synthesize the correct protein, even though the gene comes from the same organism. Explain. What would you need to do to ensure that such a yeast cell could make the correct protein?arrow_forwardThe genome of a typical bacterium contains about 5 x 106 base pairs, and can be replicated in about 30 minutes. The human genome is 600 times larger (3 × 10° base pairs), and at the rate of a bacterium, it would require 300 hours (~12 days) to be replicated; yet the entire human genome can be replicated within several hours. How is this possible?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA Use In Forensic Science; Author: DeBacco University;https://www.youtube.com/watch?v=2YIG3lUP-74;License: Standard YouTube License, CC-BY
Analysing forensic evidence | The Laboratory; Author: Wellcome Collection;https://www.youtube.com/watch?v=68Y-OamcTJ8;License: Standard YouTube License, CC-BY