![Genetics: From Genes To Genomes (6th International Edition)](https://www.bartleby.com/isbn_cover_images/9781260041217/9781260041217_largeCoverImage.gif)
Genetics: From Genes To Genomes (6th International Edition)
6th Edition
ISBN: 9781260041217
Author: Leland Hartwell Dr., ? Michael L. Goldberg Professor Dr., ? Janice Fischer, ? Leroy Hood Dr.
Publisher: Mcgraw-Hill
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 15, Problem 9P
An example of a gene-targeting DNA plasmid vector for insertion of a transgene into chloroplast DNA by biolistic transformation is shown in the following diagram. The plasmid DNA can be prepared in large quantities in E. coli before being shot into plant cells with a gene gun. Match the component of the construct with its function. (RE1, RE2, and RE3 are different restriction enzyme recognition sites unique to the plasmid vector.)
a. spectinomycin | 1. DNA that mediates resistance gene integration |
b. cpDNA sequences | 2. gene used to select chloroplast transformants |
c. RE2 | 3. sequence for plasmid replication in E. coli |
d. ori | 4. sites at which targeting chloroplast DNA can be inserted into the vector |
e. RE1 and RE3 | 5. site at which transgene can be inserted into the vector |
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
You have set up a recombinant DNA experiment using the plasmid PBR322 as the vector (see plasmid below). You use the BamHI restriction site on the plasmid to insert the target DNA. The
plasmid is then used to transform E.coli colls Is the following statement True or False?
Growth of the transformed cells on agar containing both ampicillin and tetracycline will eliminate any cells that do not contain a plasmid.
Clal Hindlll
EcoRI
Pvul
BamHI
Pstl
amp
tet
PBR322
-Sall
ori
rop
Pvull
True
False
When cloning a foreign DNA fragment into a plasmid, it is often useful to insert the fragment at a site that interrupts a selectable marker(such as the tetracycline-resistance gene of pBR322). The loss of function of the interrupted gene can be used to identify clones containing recombinant plasmids with foreign DNA. With a yeast artificial chromosome (YAC) vector, it is not necessary to do this; the researcher can still distinguish vectors that incorporate large foreign DNA fragments from those that do not. How are these recombinant vectors identified?
After transformation you were asked to grow bacterial cells transformed with plasmid on a plate that had X-gal and ampicillin. X-Gal is often used as in indicator dye, which turns blue when metabolized by B-galactosidase protein and used to test if cloning experiments have worked. [Note look at the vector diagrams carefully]
Briefly explain how you would find the bacterial cells that are transformed with the plasmid with the YFG inserted.
Chapter 15 Solutions
Genetics: From Genes To Genomes (6th International Edition)
Ch. 15 - Match each numbered item with the most closely...Ch. 15 - Assuming human cells have on average 1000...Ch. 15 - Reverse translation is a term given to the process...Ch. 15 - The human nuclear genome encodes tRNAs with 32...Ch. 15 - The human mitochondrial genome includes no genes...Ch. 15 - How do you know if the halibut you purchased at...Ch. 15 - Is each of these statements true of chloroplast or...Ch. 15 - Suppose you are characterizing the DNA of a...Ch. 15 - An example of a gene-targeting DNA plasmid vector...Ch. 15 - Which of the following characteristics of...
Ch. 15 - The Saccharomyces cerevisiae nuclear gene ARG8...Ch. 15 - The so-called hypervariable regions HV1 and HV2 of...Ch. 15 - Suppose a new mutation arises in a mitochondrial...Ch. 15 - Describe at least two ways in which the...Ch. 15 - Why are severe mitochondrial or chloroplast gene...Ch. 15 - Suppose you are examining a newly found plant...Ch. 15 - A form of male sterility in corn is inherited...Ch. 15 - Plant breeders have long appreciated the...Ch. 15 - A mutant haploid strain of Saccharomyces...Ch. 15 - Prob. 20PCh. 15 - What characteristics in a human pedigree suggest a...Ch. 15 - The first person in the family represented by the...Ch. 15 - In 1988, neurologists in Australia reported the...Ch. 15 - If you were a genetic counselor and had a patient...Ch. 15 - Kearns-Sayre syndrome KSS, Pearson syndrome, and...Ch. 15 - Many clinically relevant mitochondrial diseases...Ch. 15 - Leigh syndrome is characterized by psychomotor...Ch. 15 - All mutations in mitochondrial genes ultimately...Ch. 15 - How could researchers have determined that the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In bacterial transformation, the purpose of having antibiotic within an agar plate is to: Select one: confirm which plasmids been have successfully ligated with a gene of interest. isolate bacteria which have been successfully transformed with the plasmid. indicate which plasmids were successfully digested by the endonuclease. act as a substrate which will be cleaved and produce a blue product when ligation is unsuccessful. show which plasmids contain the lacZ gene.arrow_forwardUsing the plasmid map of pBCH2.0 provided above, predict how many DNA fragments would be formed if this plasmid was digested with restriction enzyme BamHI.arrow_forwardMany resistance mechanisms are encoded on plasmids. These mechanisms are of great clinical significance, because they can spread very easily through horizontal gene transfer. A culture of the bacterial isolate is grown, and plasmid DNA is isolated using a spin column-based solid phase extraction method. The purified plasmid DNA is then submitted for next-generation sequencing. Bioinformatic analyses of the sequencing results suggests that the following gene is likely involved in antibiotic resistance: > putative antibiotic resistance gene ATGCGTGTATTAGCCTTATCGGCTGTGTTTTTGGTGGCATCGATT ATCGGAATGCCTGCGGTAGCAAAGGAATGGCAAGAAAACAAAAGT TGGAATGCTCACTTTACTGAACATAAATCACAGGGCGTAGTTGTG CTCTGGAATGAGAATAAGCAGCAAGGATTTACCAATAATCTTAAA CGGGCGAACCAAGCATTTTTACCCGCATCTAGTGCGAAAATTCCC AATAGCTTGATCGCCCTCGATTTGGGCGTGGTTAAGGATGAACAC CAAGTCTTTAAGTGGGATGGACAGACGCGCGATATCGCCACTTGG AATCGCGATCATAATCTAATCACCGCGATGAAATATTCAGTTGTG CCTGTTTATCAAGAATTTGCCCGCCAAATTGGCGAGGCACGTATG…arrow_forward
- The modifiedplasmid is reintroduced back into Rhizobium(step 4) and the genetically transformed bacteria are then selected based on the amp and lacZgenes present within the plasmid. The plasmid may or may not integrate the BBW resistancegene. The treated bacteria may or may not take up the modified plasmid. a) Complete the table below with a yes or no in each space stating whether you would expect these bacteria to grow or not. Type of treated bacteria culture plate(no amp) Culture plate treated with ampicillin Plasmid not taken up Plasmid taken up (WithoutBBW resistancegene) Plasmid taken up (WithBBW resistancegene) B) Outline how the genetically transformed bacteria containing the BBW resistance gene can beselected based on the amp and lacZgenes present within the plasmid.arrow_forwardA pyrimidine dimer which is a bulky lesion has mutated an E. coli cell's DNA. Describe both the photoreactivation enzyme repair (PRE) and Nucleotide excision repair describe how the cell uses Uvr A, B, C, D gene products to effect repair.arrow_forwardA plasmid, pUC18, contains the ampicillin-resistance gene, the origin of replication, and the ß - gal gene, which codes for the B-galactosidase protein. This protein can break down the synthetic chemical X-gal, producing a blue product that stains the entire cell blue (but is harmless to the bacteria). At the beginning of the B-gal gene there are several unique restriction sites (some of them are shown in the diagram below). You wish to clone a 1.0-kb Xbal fragment into the pUC18 plasmid, so you cut the plasmid with Xbal and, after removing the enzyme, mix the Xbal-cut plasmid with the 1.0-kb fragment, ligate, and transform competent bacteria. Pati Xbal EcoRI B-gal A Amp ori Figure: pUC18 plasmid map (a) On what medium would you grow your transformed bacteria? (b) Do you expect the bacteria carrying plasmid pUC18 (without the insert) to be blue or white when grown in the presence of X-gal? Explain.arrow_forward
- You are studying a new plasmid, and you digest the plasmid with three restriction enzymes: Eco RI (E), HindlII (H), and Xbal (X). You digest the plasmid DNA with each of the following combinations of enzymes and observe the results on an agarose gel. You are provided a partial plasmid map as shown below to the right. E+H E+X H+x Kb +4.3 +2.8 -+2.5 -2.0 - -1.8 +1.5 -1.0 12 F0.8 +0.5 a. What is the size of this plasmid in base pairs? b. What is the distance in base pairs between E1 and H? c. What is the distance in base pairs between E1 and X? d. What is the distance in base pairs between E2 and H? e. What is the distance in base pairs between E2 and X?arrow_forwardYou utilised two plasmids in this practical, pOTC and pOTC-Δ. Plasmids are often represented using plasmid maps like the one below. This map shows the positions of recognition sites for a number of restriction enzymes Using the plasmid map of pBCH2.0 provided above, predict how many DNA fragments would be formed if this plasmid was digested with restriction enzymes EcoRI and PvuII.arrow_forwardIn this western blot, the levels of phosphorylated TBK (PTBK) decrease with increasing amounts/expression of the viral protein (VP). Figure description: Increasing amounts of a plasmid expressing the viral protein (0.5, 1, or 2ug) were cotransfected with TBK1 expression plasmid. Cells were harvested 24 h post-transfection and analyzed for phosphorylated TBK1 (anti- TBK1 Ser172), total TBK1 (anti-TBK1), B-actin (anti-B-actin), and viral protein (anti-VP) expression by Western blot analysis. VP PTBK1 (S172) TBK1 actin Virus proteins O True O Falsearrow_forward
- The map of plasmid pUC19 is shown below. The restriction site coordinate is the position of the 5’base on the top strand of each site sequence. The restriction enzyme sites are in bold type if there is only one site in pUC19. Please list the fragments in order of size, largest to smallest, which will result from a complete digestion by the restriction enzyme PvuII. Please list the fragments in order of size, largest to smallest, which will result from a complete digestion by the restriction enzyme DrdI.arrow_forwardBacterial plasmids often serve as cloning vectors. Describe the essential features of a plasmid vector.arrow_forwardWhen using a conventional plasmid cloning vector containing a b-galactosidase gene, it is possible to perform a "blue-white screen" to determine which bacteria have taken up a plasmid into which a DNA fragment as been inserted, as opposed to those that have taken up just reclosed plasmid vector, by growing the transformed cells on nutrient agar plates containing the artificial b-gal substrate X-gal. Will bacteria that have taken up a plasmid into which a DNA fragment has been inserted form a blue colony or a white colony when grown on this medium? Briefly explain why these bacteria would form a colony of the color you chose.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License