BIOLOGY >PRINT UPGRADE<
11th Edition
ISBN: 9780357091586
Author: Solomon
Publisher: CENGAGE L
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 15.2, Problem 1C
Summary Introduction
To draw: A diagram showing a bacterial CRISPR locus and label each component within the locus.
Concept introduction: CRISPR or “clustered regularly interspaced short palindromic repeats” are short viral origin DNA repeats that are found in bacteria. Cas is CRISPR-associated endonucleases enzyme that excises the DNA. Therefore, CRISPR-Cas9 recognizes the invading virus and cleaves it. CRISPR-Cas9 system is used as a gene editing tool to genetically correct the disease causing mutations. This is used to edit the gene in the germ line of viable human embryos. These changes are heritable.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Design a oligonucleotide probe for provided gene sequence using all the guidelines for efficient probe designing.
ACAACCCCAAGCCTTCAACCACCCCCTTCCCCCAAATTAGAGATCGATCTCAAGAAGAAGAATGGGTTCCGTCTCTCGCTCTTCTTTGGATCAGAAGCTGGCCATGGCAAAGCGCTGCTCCCACGAGGGAGTTGTCGCGGGAGCAAAGGCGGCCGTGGTTGCAACTGTTGCCTCGGCCATTCCTACTTTGGCTAGCGTTAGGATGATCCCATGGGCGAGGTCCTTCCTTAATCCCGCAGCTCAGGCCCTCATCGTTTCATCAGCGGCGGGGGCGGCGTACTTCATAGTTGCGGACAAGAC
Genomic sequencing cannot be used to:
Predict a protein coding gene
Predict structure and function of a protein encoded in a gene
Locate similar sequences (sequence homology)
Locate repetitive sequences
Predicting alternative splicing patterns
Describe the features of a typical CRISPR locus in a bacterial cell.
Chapter 15 Solutions
BIOLOGY >PRINT UPGRADE<
Ch. 15.1 - Prob. 1LOCh. 15.1 - Explain how gel electrophoresis is used to...Ch. 15.1 - Describe how PCR is used to amplify a specific...Ch. 15.1 - Compare the possible differences between a...Ch. 15.1 - Prob. 1CCh. 15.1 - Different forms of a protein are produced in the...Ch. 15.1 - What advantages does the PCR method have over gene...Ch. 15.2 - Describe the features of a typical CRISPR locus in...Ch. 15.2 - Explain the function of CRISPR in bacterial cells.Ch. 15.2 - Compare CRISPR-based endonucleases with...
Ch. 15.2 - Prob. 8LOCh. 15.2 - Prob. 1CCh. 15.2 - Prob. 2CCh. 15.2 - Prob. 3CCh. 15.3 - Prob. 9LOCh. 15.3 - Prob. 10LOCh. 15.3 - Discuss how qPCR, DNA microarrays (DNA chips), and...Ch. 15.3 - Explain how you would compare the expression of a...Ch. 15.3 - Prob. 2CCh. 15.4 - Describe how genome-wide association studies have...Ch. 15.4 - Explain how targeted gene silencing and knockout...Ch. 15.4 - Prob. 1CCh. 15.5 - Describe at least one important application of DNA...Ch. 15.5 - Prob. 1CCh. 15.5 - What are short tandem repeats (STRs), and why are...Ch. 15.5 - Why do gene targeting and mutagenesis screening in...Ch. 15.6 - Prob. 15LOCh. 15.6 - Prob. 16LOCh. 15.6 - Prob. 1CCh. 15.6 - Prob. 2CCh. 15.7 - Describe at least two safety issue associated with...Ch. 15.7 - What are some of the environment concerns...Ch. 15 - A plasmid (a) can be used as a DNA vector (b) is a...Ch. 15 - DNA molecules with complementary sticky ends...Ch. 15 - Prob. 3TYUCh. 15 - Which technique rapidly replicated specific DNA...Ch. 15 - Prob. 5TYUCh. 15 - A cDNA clone contains (a) introns (b) exons (c)...Ch. 15 - Prob. 7TYUCh. 15 - Gel electrophoresis separates nucleic acids on the...Ch. 15 - A CRISPR locus in a bacterium contains (a) short...Ch. 15 - DNA molecular with complementary sticky ends...Ch. 15 - These highly polymorphic molecular markers are...Ch. 15 - Prob. 12TYUCh. 15 - Prob. 13TYUCh. 15 - Prob. 14TYUCh. 15 - EVOLUTION LINK DNA technology, such as the...Ch. 15 - SCIENCE, TECHNOLOGY, AND SOCIETY What are some...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Briefly explain why RNA-seq gives more information about the transcriptome than does microarray analysis.arrow_forwardPlace the steps necessary to perform RNA-Seq in the correct order. Drag the text blocks below into their correct order. Reset MAAAAAAAAAKK MAAAAAAAAAAM Compare sequences to known genome sequence. Create cDNA using reverse transcription with primers complementary to linkers. Attach linkers to the ends of the RNAs. Perform next-generation DNA sequencing. Isolate RNA from cells or tissues of interest. Fragment the RNAs.arrow_forwardLay out the steps in transcriptome analysis RNA-Seq and microarrays that lets you identify disease-causing genes. Like for example, Down syndrome.arrow_forward
- Transcribe and translate the following template sequence: CACGTAAAG.arrow_forwardIn biotechnology, gene cloning is a very important technique. A vector is normally required to perform this process. The vector commonly used to transform a bacterial host cell is the plasmid. State the three (3) important regions of the plasmid. Elaborate your answer.arrow_forwardPlease place the stages of a CRISPR-cas9 gene editing workflow in the correct order below. Note, there is one incorrect and state why? Sequence Select for correctly gene edited cells (using antibiotic resistance and/or colour production for example) Clonal isolation Synthesise DNA insert oligonucleotides Clonal characterisation (analysis of phenotype) Add green fluorescent protein gene sequence into plasmid to aid selection of correctly transfected cells. Transfect cells Clone into CRISPR-cas9 expression vector Purify plasmids Design a set of targeting sequences using algorithms.arrow_forward
- This descriptor refers to the highest alignment score of all matched sequences to the sequence placed in the BLASTn search. Query cover Maximum score and Total score E-value Ident Accession numberarrow_forwardDiscuss which barcodes to use for bacteria, animals, plants and fungi and why with references (1000 words)arrow_forwardDescribe the basic components of CRISPR.arrow_forward
- Diagram and explain how APEX probes can be used to determine that an individual is CC (homozygous) for a specific G/C SNV. Recall that the genotype of an SNV is identified from the strand shown in NCBI. What color fluorescence will be observed? Also, explain why a left apex probe cannot be used for this SNV. The SNV sequence, on the strand shown in NCBI, and a few nucleotides adjacent to the SNV are below: 5'-------TGT(G/C)CAG------3'arrow_forwardBoth microarray and RNA-sequencing can study the transcriptomes. Compare microarray and RNA sequencing technique in analyzing gene with high, medium and low copy number of genes.arrow_forwardBriefly outline the components of the CRISPR/Cas systemarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license