Concept explainers
Figure 16.5 In E. coli, the tip operon is on by default, while the lac operon is off. Why do you think that this is the case?
To review:
The working of the trp operon and the lac operon in E.coli .
Introduction:
E.coliis a prokaryote with its DNA found clustered in a group of genes that regulate other genes responsible for protein synthesis called the operon. Depending upon the requirement, these operons regulate the gene expression by repression or induction.
Explanation of Solution
E.colineeds amino acids for the synthesis of proteins. One such amino acid required for its survival is the tryptophan. The characteristic trp operon is a group of genes that encode enzymes for the amino acid tryptophan. It is a set of five genes which transcribe into a single amino acid which is further translated to produce five enzymes. The trpoperon is turned on when the tryptophan levels are low leading to the transcription of mRNA, translation of proteins and the synthesis of tryptophan. It is turned off when the levels are high in the environment as tryptophan synthesis is not required due to its abundance. lac operon encodes the genes necessary to acquire and process the sugar lactose from the environment. Lactose is the sugar used by the bacteria only when the glucose concentration is low. Production of enzymes necessary to digest lactose when it is not available is not required. So it is turned on only when lactose is present.
Thus, these conditions of keeping the trp operon on by default and lac operon off is based on the requirement of the enzymes coding tryptophan and lactose.
Want to see more full solutions like this?
Chapter 16 Solutions
BIOLOGY 2E
Additional Science Textbook Solutions
College Physics
Concepts of Genetics (12th Edition)
Campbell Essential Biology (7th Edition)
Microbiology: An Introduction (13th Edition)
Microbiology with Diseases by Body System (4th Edition)
Campbell Biology in Focus (2nd Edition)
- Figure 14.23 shows a genetic switch that controls the choice between the lytic and lysogenic cycles of phage ?. What is a genetic switch? Compare the roles of a genetic switch and a simple operator site (like the one found in the lac operon) in gene regulation.arrow_forwardAll the following are characteristics of inducible operons except they are normally inactive they involve a repressor they are often involved in anabolic pathways they are active in the presence of an inducer they are a way for bacterial cells to conserve energyarrow_forwardThe following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′arrow_forward
- Figure 5 shows the lac operon structure in Escherichia coli. a) Name structures P, Q and R. b) Name substance S. c) What is the enzyme encoded by gene I. Give its function. d) What will happen if substance S is absent in the medium?arrow_forwardWhich of the following diagrams best models the regulation of the trp operon when tryptophan is present at high levels?arrow_forwardWhat would happen if the operator sequence of the trp operon contained a mutation that prevented the repressor protein from binding to the operator? (Explain what would happen in both the presence and absence of tryptophan)arrow_forward
- Which of the following molecules will experience a large change in cytoplasmic concentration whenthe above tryptophan operon is turned on (in E. coli cells)?A. tryptophan molecules will decrease in concentrationB. lactose molecules will decrease in concentrationC. tryptophan molecules will increase in concentrationD. lactose molecules will increase in concentrationE. none of the abovearrow_forwardWhy is step 2 correct, is it because this is a repressible operon?arrow_forwardIf tryptophan is presence in the culture media of E.coli then _________. the promoter will be accessed by the RNA polymerase the repressor will bind to the operator the structural genes of the trp operon will be expressed tryptophan will be synthesizedarrow_forward
- What are the effects of the following conditions on Lac operon of bacteria? Do not forget to mention about the role of repressor, activator, RNA polymerase in each case! A) Glucose is absent and lactose is present B) Glucose is present and lactose is present C) Glucose is present and lactose is absentarrow_forwardBacteria is grown on a media containing only lactose. Given below is the diagram of lac operon. I have to label the diagram and it says mark promoter, operator, RNA polymerase, functional genes, repressed gene,repressor, lactose mRNA, how does this operon function in the presence of lactose.arrow_forwardWhich of the following arabinose operon regulatory sites is exclusively involved in the repression of the transcription of the ara operon? ara PBAD ara O1 ara O2 the CAP binding site ara Barrow_forward
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning