Introduction to Java Programming and Data Structures: Brief Version (11th Global Edition)
11th Edition
ISBN: 9780134671710
Author: Y. Daniel Liang
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 17, Problem 17.18PE
(View bits) Write the following method that displays the bit representation for the last byte in an integer:
public static String getBits(int value)
For a hint, see
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
<<Write in Java>>
- Challenge 7
File encryption is the science of writing the contents of a file in a secret code. Your encryption program should work like a filter, reading the contents of one file, modifying the data into a code, and then writing the coded contents out to a second file. The second file will be a version of the first file, but written in a secret code. Although there are complex encryption techniques, you should come up with a simple one of your own. For example, you could read the first file one character at a time, and add 10 to the character code of each character before it is written to the second file.
- Challenge 8
Write a program that decrypts the file produced by the program in Programming Challenge 7. The decryption program should read the contents of the coded file, restore the data to its original state, and write it to another file
(Python matplotlib or seaborn)
CPU Usage
We have the hourly average CPU usage for a worker's computer over the course of a week. Each row of data represents a day of the week starting with Monday. Each column of data is an hour in the day starting with 0 being midnight.
Create a chart that shows the CPU usage over the week. You should be able to answer the following questions using the chart:
When does the worker typically take lunch?
Did the worker do work on the weekend?
On which weekday did the worker start working on their computer at the latest hour?
cpu_usage = [
[2, 2, 4, 2, 4, 1, 1, 4, 4, 12, 22, 23,
45, 9, 33, 56, 23, 40, 21, 6, 6, 2, 2, 3], # Monday
[1, 2, 3, 2, 3, 2, 3, 2, 7, 22, 45, 44,
33, 9, 23, 19, 33, 56, 12, 2, 3, 1, 2, 2], # Tuesday
[2, 3, 1, 2, 4, 4, 2, 2, 1, 2, 5, 31,
54, 7, 6, 34, 68, 34, 49, 6, 6, 2, 2, 3], # Wednesday
[1, 2, 3, 2, 4, 1, 2, 4, 1, 17, 24, 18,
41, 3, 44, 42, 12, 36, 41, 2, 2, 4, 2, 4], # Thursday
[4, 1, 2, 2, 3, 2, 5, 1, 2, 12, 33, 27,
43, 8,…
This is the file :
Chapter 17 Solutions
Introduction to Java Programming and Data Structures: Brief Version (11th Global Edition)
Ch. 17.2 - What is a text file and what is a binary file? Can...Ch. 17.2 - How do you read or write text data in Java? What...Ch. 17.3 - Prob. 17.3.1CPCh. 17.3 - How is a Java character represented in the memory,...Ch. 17.3 - If you write the string ABC to an ASCII text file,...Ch. 17.3 - If you write the string 100 to an ASCII text file,...Ch. 17.3 - What is the encoding scheme for representing a...Ch. 17.4 - Prob. 17.4.1CPCh. 17.4 - Why should you always close streams? How do you...Ch. 17.4 - Prob. 17.4.3CP
Ch. 17.4 - Does FileInputStream/Fi1eOutputStream introduce...Ch. 17.4 - What will happen if you attempt to create an input...Ch. 17.4 - How do you append data to an existing text file...Ch. 17.4 - Prob. 17.4.7CPCh. 17.4 - What is written to a file using writeByte(91) on a...Ch. 17.4 - How do you check the end of a file in an input...Ch. 17.4 - What is wrong in the following code? Import...Ch. 17.4 - Suppose you run the following program on Windows...Ch. 17.4 - After the following program is finished, how many...Ch. 17.4 - For each of the following statements on a...Ch. 17.4 - What are the advantages of using buffered streams?...Ch. 17.5 - How does the program check if a file already...Ch. 17.5 - How does the program detect the end of the file...Ch. 17.5 - How does the program count the number of bytes...Ch. 17.6 - Prob. 17.6.1CPCh. 17.6 - Prob. 17.6.2CPCh. 17.6 - Is it true that any instance of...Ch. 17.6 - Prob. 17.6.4CPCh. 17.6 - Prob. 17.6.5CPCh. 17.6 - What will happen when you attempt to run the...Ch. 17.7 - Can RandomAccessFi1e streams read and write a data...Ch. 17.7 - Create a RandomAccessFi1e stream for the file...Ch. 17.7 - What happens if the file test.dat does not exist...Ch. 17 - (Create a text file) Write a program to create a...Ch. 17 - (Create a binary data file) Write a program to...Ch. 17 - (Sum all the integers in a binary data file)...Ch. 17 - (Convert a text file into UTF) Write a program...Ch. 17 - Prob. 17.5PECh. 17 - Prob. 17.6PECh. 17 - Prob. 17.7PECh. 17 - (Update count) Suppose that you wish to track how...Ch. 17 - (Address book) Write a program that stores,...Ch. 17 - (Split files) Suppose you want to back up a huge...Ch. 17 - (Split files GUI) Rewrite Exercise 17.10 with a...Ch. 17 - Prob. 17.12PECh. 17 - (Combine files GUI) Rewrite Exercise 17.12 with a...Ch. 17 - (Encrypt files) Encode the file by adding 5 to...Ch. 17 - (Decrypt files) Suppose a file is encrypted using...Ch. 17 - (Frequency of characters) Write a program that...Ch. 17 - (BitOutputStream) Implement a class named...Ch. 17 - (View bits) Write the following method that...Ch. 17 - (View hex) Write a program that prompts the user...Ch. 17 - (Hex editor) Write a GUI application that lets the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.Similar questions
- (PYTHON) A photographer is organizing a photo collection about the national parks in the US and would like to annotate the information about each of the photos into a separate set of files. Write a program that reads the name of a text file containing a list of photo file names. The program then reads the photo file names from the text file, replaces the "_photo.jpg" portion of the file names with "_info.txt", and outputs the modified file names. Assume the unchanged portion of the photo file names contains only letters and numbers, and the text file stores one photo file name per line. If the text file is empty, the program produces no output. Ex: If the input of the program is: ParkPhotos.txt and the contents of ParkPhotos.txt are: Acadia2003_photo.jpg AmericanSamoa1989_photo.jpg BlackCanyonoftheGunnison1983_photo.jpg CarlsbadCaverns2010_photo.jpg CraterLake1996_photo.jpg GrandCanyon1996_photo.jpg IndianaDunes1987_photo.jpg LakeClark2009_photo.jpg Redwood1980_photo.jpg…arrow_forward### Exercise in Python1 ###\n", "\n", "Open the text oneArt.txt, read the text line by line and, at the end, print the number of lines of text that are in the file. Do not count blank lines."arrow_forwardusing c++ programming ::::: 16. (Pick 5 Lotto) Write a program to simulate a pick-5 lottery game. Your program should generate and store 5 distinct numbers between 1 and 9 (inclusive) into an array. The program prompts the user to enter five distinctbetween 1 and 9 and stores the number into another array. The programthen compares and determines whether the two arrays are identical. If thetwo arrays are identical, then the user wins the game; otherwise the program outputs the number of matching digits and their position in the array.Your program must contain a function that randomly generates thepick-5 lottery numbers. Also, in your program, include the functionsequential search to determine if a lottery number generated hasalready been generated.arrow_forward
- Answer the given question with a proper explanation and step-by-step solution. 1- Write code that does the following: opens an output file with the filename number_list.txt, uses a loop to write the numbers 1 through 100 to the file, then closes the file.arrow_forwardModified Programming ). (Count vowels and consonants, file input, nested-loops, switch statement) Assume that letters A, E, I, O and U are the vowels. Write a program that reads strings from a text file, one line at a time, using a while-loop. You do the following operations within each loop: • Read one line from the input file and store it in a string; Count the number of vowels and consonants (using either while-loop or for-loop) in the file string. The while-loop will terminate when the end-of-file is reached. After the loop is finished, the program displays the total number of vowels and consonants in the text file. [A text file, named “ass4_Q6_input.txt", is provided as your testing input file.]arrow_forwardLanguage: JAVA Problem 1: Decimal to Binary Conversion Write a program that takes an integer value as an input and converts that value to its binary representation; for instance, if the user inputs 17, then the output will be 10001. Do not forget to check for valid input, which means if the user inputs a type of data other than an integer re-prompt the user to enter a valid value. The output binary number can be a string. Sample input and output: Enter an integer > a You entered an invalid type. Try again. Enter an integer > 17 10001arrow_forward
- Q/in python Open a file and write a program in C++, for example: #include void main { int x int y x=x+y } Then read it via Python and convert it to token and token type 1- Solve the example above 2- Give me your example and solve it tooarrow_forward(C Language) A photographer is organizing a photo collection about the national parks in the US and would like to annotate the information about each of the photos into a separate set of files. Write a program that reads the name of a text file containing a list of photo file names. The program then reads the photo file names from the text file, replaces the "_photo.jpg" portion of the file names with "_info.txt", and outputs the modified file names. Assume the unchanged portion of the photo file names contains only letters and numbers, and the text file stores one photo file name per line. If the text file is empty, the program produces no output. Assume also the maximum number of characters of all file names is 100.arrow_forward15). (Remove text) Write a program that removes all the occurrences of a specified string from a text file. (For example, my Aunt went to buy Medicines while Sam and I play Soccer. Removes the string Sam from the file.) 1) You should create a file with this paragraph. 2) removes the string "John and" from the file. Note:- Please write a java code and also need an output for this program. (Also, let me know with what name file should be saved to get output)arrow_forward
- Python programming-basics homework assignment: Write a program that inputs a text file, should print unique words in file in abc order, uppercase words should take precedence over lower. this is example of output: example text file: brown dog fox jumps lazy over quick the example output: brown dog fox jumps lazy over quick the THis is MY output: thequickbrownfoxjumpsoverthelazydog This is my code: QUESTION: why it won't SORT or removing unique text like example output: # Put your code herefileName = input("Enter the input file name:")word_list = []with open(fileName) as words: for line in words: line.rstrip() for list_of_words in line.split(): print(list_of_words) word_list.sort() for list2_words in word_list: if list2_words not in word_list: word_list.sort() word_list.append(list_of_words) for new_words in line.split(): print(new_words)arrow_forwardC++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…arrow_forward2. Printing binary Write a function void printBin(int value) that will print an integer as a binary number. Hint: You want to print a 1 or a O based on the high order bit, then you need to move the next to high order bit into the high order bit. You will need to explicitly count the number of bits you have printed. Write a main method that calls printBin multiple times with a few different values to test it. You should try at least a positive number, a negative number and O. Your submission should answer the following questions about this program: • There are at least two approaches to testing the high order bit. Describe one that you did NOT use in your code. • How could you suppress leading zeros in you display? If you did this already, you may just answer that you did.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Database System ConceptsComputer ScienceISBN:9780078022159Author:Abraham Silberschatz Professor, Henry F. Korth, S. SudarshanPublisher:McGraw-Hill EducationStarting Out with Python (4th Edition)Computer ScienceISBN:9780134444321Author:Tony GaddisPublisher:PEARSONDigital Fundamentals (11th Edition)Computer ScienceISBN:9780132737968Author:Thomas L. FloydPublisher:PEARSON
- C How to Program (8th Edition)Computer ScienceISBN:9780133976892Author:Paul J. Deitel, Harvey DeitelPublisher:PEARSONDatabase Systems: Design, Implementation, & Manag...Computer ScienceISBN:9781337627900Author:Carlos Coronel, Steven MorrisPublisher:Cengage LearningProgrammable Logic ControllersComputer ScienceISBN:9780073373843Author:Frank D. PetruzellaPublisher:McGraw-Hill Education
Database System Concepts
Computer Science
ISBN:9780078022159
Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan
Publisher:McGraw-Hill Education
Starting Out with Python (4th Edition)
Computer Science
ISBN:9780134444321
Author:Tony Gaddis
Publisher:PEARSON
Digital Fundamentals (11th Edition)
Computer Science
ISBN:9780132737968
Author:Thomas L. Floyd
Publisher:PEARSON
C How to Program (8th Edition)
Computer Science
ISBN:9780133976892
Author:Paul J. Deitel, Harvey Deitel
Publisher:PEARSON
Database Systems: Design, Implementation, & Manag...
Computer Science
ISBN:9781337627900
Author:Carlos Coronel, Steven Morris
Publisher:Cengage Learning
Programmable Logic Controllers
Computer Science
ISBN:9780073373843
Author:Frank D. Petruzella
Publisher:McGraw-Hill Education
Literals in Java Programming; Author: Sudhakar Atchala;https://www.youtube.com/watch?v=PuEU4S4B7JQ;License: Standard YouTube License, CC-BY
Type of literals in Python | Python Tutorial -6; Author: Lovejot Bhardwaj;https://www.youtube.com/watch?v=bwer3E9hj8Q;License: Standard Youtube License