WORLD OF CELL+MASTERING ACCESS >CUSTOM
9th Edition
ISBN: 9781323445044
Author: Hardin
Publisher: PEARSON C
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 17, Problem 17.2CC
Nonhomologous end-joining and synthesis-dependent strand annealing are both strategies eukaryotes use to repair double-strand breaks in DNA. Because SDSA is error-free and NHEJ is error-prone, why don’t eukaryotic cells always use SDSA?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Two pathways, homologous recombination and nonhomologous end joining (NHEJ), can repair double-strandbreaks in DNA. If homologous recombination is an errorfree pathway whereas NHEJ is not always error free, whyis NHEJ used most of the time in eukaryotes?
Prokaryotic DNA is normally slightly negatively supercoiled, which can lead to "DNA breathing". How or why does supercoiling lead to DNA "breathing"?
In eukaryotes, what is meant by the term DNA replication licensing? How does the process occur?
Chapter 17 Solutions
WORLD OF CELL+MASTERING ACCESS >CUSTOM
Ch. 17 - The theoretical amplification accomplished by n...Ch. 17 - Bacterial replication and that in typical...Ch. 17 - Nonhomologous end-joining and synthesis-dependent...Ch. 17 - Prob. 17.3CCCh. 17 - Meselson and Stahl Revisited. For each of the...Ch. 17 - DNA Replication. Sketch a replication fork of...Ch. 17 - More DNA Replication. The following are...Ch. 17 - QUANTITATIVE Still More DNA Replication. Suppose...Ch. 17 - The Minimal Chromosome. To enable it to be...Ch. 17 - Prob. 17.6PS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The chain terminator method was used to sequence the following DNA fragment: ACTGGGCATAAGCGGGAACTTTGCAGAACTGGCTGGCCTCAGAGCAGGGA. 1. Predict a band pattern in a gel after sequencing this DNA fragment using a radioactively labeled primer [32P]-5’- TCTGAGGCCAGCCAGTTCTGCAAAGTTC. 2. Due to an experimental mistake, dATP was not added in all four reaction mixtures. How does the band pattern change?arrow_forwardWhat is an Okazaki fragment? In which strand of replicating DNA are Okazaki fragments found? Based on the properties of DNA polymerase, why is it necessary to make these fragments?arrow_forwardThe 3′-exonuclease activity of E. coli DNA polymerase I was found to show no discrimination between correctly and incorrectly base-paired nucleotides at the 3′-terminus; properly and improperly base-paired nucleotides are cleaved at equal rates there. How can this observation be reconciled with the fact that the 3′-exonuclease activity increases the accuracy with which template DNA is copied?arrow_forward
- Supercoiled DNA is slightly unwound compared to relaxed DNA and this enables it to assume a more compact structure with enhanced physical stability. Describe the enzymes that control the number of supercoils present in the E. coli chromosome. How much would you have to reduce the linking number to increase the number of supercoils by five?arrow_forwardCytosine can be deaminated to form Uracil What type of mutation is this classified as? Discuss what happens to the base-pairing properties from switching from C to U? When U is replicated in two rounds of synthesis, what substitution does this result in? Before Uracil alters the DNA during replication, what repair system can be used to correct this error? Describe how this type of DNA repair works?arrow_forwardDNA polymerases are capable of editing and error correction, meaning it is able to edit and correct single base error so that the gene is not affected. However, RNA polymerase has a limited capacity for error correction. Given that a single base error in either replication or transcription can lead to error in protein synthesis, suggest a brief explanation for this difference in the capability of error correction between DNA polymerase and RNA polymerase.arrow_forward
- DNA topoisomerases play important roles in DNA replication and in supercoiling . These enzymes are also the targets for certain anticancer drugs (see the introduction to this chapter). Eric Nelson and his colleagues studied m-AMSA, one of the anticancer compounds that acts on topoisomerase (E. M. Nelson, K. M. Tewey, and L. F. Liu. 1984. Proceedings of the National Academy of Sciences of the United States of America 81:1361–1365). They found that m-AMSA stabilizes an intermediate produced in the course of topoisomerase action. The intermediate consists of topoisomerase bound to the broken ends of the DNA. Breaks in DNA that are produced by anticancer compounds such as m-AMSA inhibit the replication of the cellular DNA and thus stop cancer cells from proliferating. Explain how m-AMSA and other anticancer agents that target topoisomerase enzymes taking part in replication might lead to DNA breaks and chromosome rearrangements.arrow_forward• Kornberg and his colleagues incubated soluble extracts of E. coli with a mixture of dATP, dTTP, dGTP, and dCTP, all labeled with 32P in the α-phosphate group. After a time, the incubation mixture was treated with trichloroacetic acid, which precipitates the DNA but not the nucleotide precursors. The precipitate was collected, and the extent of precursor incorporation into DNA was determined from the amount of radioactivity present in the precipitate.a. If any one of the four nucleotide precursors were omitted from the incubation mixture, would radioactivity be found in the precipitate? Explain.b. Would 32P be incorporated into the DNA if only dTTP were labeled? Explain.c. Would radioactivity be found in the precipitate if 32P labeled the or phosphate rather than the phosphate of the deoxyribonucleotides? Explain.arrow_forwardIn reversible terminator sequencing, how would the sequencing process be affected if the 3′-end-blocking group of each nucleotide were replaced with the 3′-H present in the dideoxynucleotides used in Sanger sequencing?arrow_forward
- Considering prokaryotes, what is the enzyme that helps hold DNA polymerase III in place when nucleotides are being added?arrow_forwardE. coli DNA polymerase V has the ability to bypass thymine dimers. However, Pol V tends to incorporate G rather than A opposite the damaged T bases. Would you expect Pol V to be more or less processive than Pol III? Explain.arrow_forwardHuman genomic libraries used for DNA sequencing are often made from fragments obtained by cleaving human DNA with Haeiii in such a way that the DNA is only partially digested; that is, not all the possible HaeIII sites have been cleaved. What is a possible reason for doing this?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
genetic recombination strategies of bacteria CONJUGATION, TRANSDUCTION AND TRANSFORMATION; Author: Scientist Cindy;https://www.youtube.com/watch?v=_Va8FZJEl9A;License: Standard youtube license