WORLD OF CELL+MASTERING ACCESS >CUSTOM
9th Edition
ISBN: 9781323445044
Author: Hardin
Publisher: PEARSON C
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 17, Problem 17.3PS
More
(a) Neither of the two DNA polymerases of F. mungus appears to have an exonuclease activity.
(b) Replicating DNA from F. mungus shows discontinuous synthesis on both strands of the replication fork.
(c) Some of the DNA sequences from F. mungus are present in multiple copies per genome, whereas other sequences are unique.
(d) Short fragments of F. mungus DNA isolated during replication contain both ribose and deoxyribose.
(e) F. mungus cells are grown in the presence of the heavy isotopes 15N and 13C for several generations and then grown for one generation in normal (14N, 12C) medium; then DNA is isolated from these cells and denatured. The single strands yield a single band in a cesium chloride density gradient.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Question:-
Explain why there are very few sequence-specific DNA-binding proteins that bind to the minor groove of double-stranded DNA.
True or false ? Reactions in our cells happen in a perfect way, therefore DNA replication is error free
Central Dogma of Molecular Biology from DNA to RNA to Protein, discussing the principles underlying the transfer of information in a biologic system and its regulation.
However, recent research seems to challenge certain aspects of Crick’s Central Dogma.
Does the Central Dogma still stand today? If not, can you find an example for a type of information transfer that is not explicitly covered by the Central Dogma (or even violates it)?
Chapter 17 Solutions
WORLD OF CELL+MASTERING ACCESS >CUSTOM
Ch. 17 - The theoretical amplification accomplished by n...Ch. 17 - Bacterial replication and that in typical...Ch. 17 - Nonhomologous end-joining and synthesis-dependent...Ch. 17 - Prob. 17.3CCCh. 17 - Meselson and Stahl Revisited. For each of the...Ch. 17 - DNA Replication. Sketch a replication fork of...Ch. 17 - More DNA Replication. The following are...Ch. 17 - QUANTITATIVE Still More DNA Replication. Suppose...Ch. 17 - The Minimal Chromosome. To enable it to be...Ch. 17 - Prob. 17.6PS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Tick the correct statements: Remember: Tautomers are structural isomers that differ from each other based on the position of the proton(s) and their double bonds. ( ) The nitrogenous bases of nucleic acids, which contain heterocyclic and analogous nuclei, can adopt different tautomeric forms involving multiple H+ that are exchangeable depending on the medium. In DNA, spontaneous formation of smaller tautomers appears to contribute to mutagenic errors during DNA replication, while in RNA, they seem to be related to increased structural and functional diversity of enzymes and RNA aptamers (research this and confirm if it is false or real) ( ) in relation to the figure, anomer 1 has beta stereochemistry with respect to the C anomeric of the pentose, and is making an N-glycosidic bond ( ) in relation to the figure, anomer 1 has alpha stereochemistry with respect to the C anomeric of the pentose, and is making an N-glycosidic bond ( ) In general, in naturally occurring nucleosides,…arrow_forwardsignal transduction- yeast genetics In one sentence, what is the URA3- to URA3+ conversion with plasmid transformation? Why is it necessary to do this first?arrow_forwardSemiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724 g/mL, 14N-labeled DNA has a density of 1.710 g/mL, and E. coli cells grown for many generations on 14NH4+as a nitrogen source are transferred to media containing 15NH4+as the sole N-source, (a) What will be the density of the DNA after one generation, assuming replication is semiconservative? (b) Suppose replication took place by a conservative mechanism in which the parental strands remained together and the two progeny strands were paired. Design an experiment that could distinguish between semiconservative and conservative modes of replication.arrow_forward
- Number of Okazaki Fragments in E. coli and Human DNA Replication Approximately how many Okazaki fragments are synthesized in the course of replicating an E. coli chromosome? How many in replicating an “average� human chromosome?arrow_forwardNot just generic "degradation" or even shorter DNA fragments, what specific structure change in double-stranded DNA does the hyperchromicity effect show?arrow_forwardINSTRUCTION: Given the DNA sequence below, provide the answers to the following items. a. complimentary DNA strand 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C b. mRNA 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C c. protein synthesized 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A Carrow_forward
- - cytogenetics- Give me an example of make up a crime scene scenario in which DNA from a nonhuman provided critical evidence.arrow_forwardQuick help Only cell biology Which process is described in the following paragraph? During DNA synthesis, before the enzyme adds the next nucleotide to a growing DNA strand, it checks whether the previously added nucleotide is correctly base-paired to the template strand. If so, the polymerase adds the next nucleotide; if not, the polymerase clips off the mispaired nucleotide and tries again. This is carried out by cleaving the phosphodiester backbone using the enzyme’s 3’-to-5’ exonuclease activity.arrow_forwardTrue or false? DNA repair mechanisms all depend on the existence of two copies of the genetic information, one in each of the homologous chromosomes. DNA primase makes DNA primers for the synthesis of Okazaki fragments in the DNA lagging strand. The repair of double-stranded breaks by nonhomologous end joining is accurate. RNA polymerase III transcribes all protein-coding genes.arrow_forward
- 4a in context to taking genomic DNA from eukaryotic cells and randomly shearing it into pieces of a constant size, why do some of the genomic DNA fragments re-nature so much more quickly than other fragmentsarrow_forwarda. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =arrow_forwardHow many sites? A researcher has isolated a restriction endonuclease that cleaves at only one particular 10-base-pair site. Would this enzyme be useful in protecting cells from viral infections, given that a typical viral genome is 50,000 base pairs long? Explainarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license