Inquiry In Action: Interpreting Scientific Papers
11th Edition
ISBN: 9780134478616
Author: Urry, Lisa A.; Cain, Michael L.; Wasserman, Steven A.; Minorsky, Peter V.; Reece, Jane B.; Buskirk, Ruth V.; Gillen, Christopher M.
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 17, Problem 6TYU
Using Figure 17.6, identify a 5' → 3' sequence of
(A) 5'-UUUCCCAAA-3'
(B) 5'-GAACCCCTT-3'
(C) 5'- CTTCGGGAA-3'
(D) 5'-AAACCCUUU-3'
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’
a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence?
b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence?
c) What would be the other strand of DNA?
Consider the following sequence of DNA: 3'-TTA CGG-5'What dipeptide is formed from this DNA after transcription and translation? b. If a mutation converts CGG to CGT in DNA, what dipeptide is formed? c. If a mutation converts CGG to CCG in DNA, what dipeptide is formed? d. If a mutation converts CGG to AGG in DNA, what dipeptide is formed?
For a DNA template strand containing the sequence 3'AATTGGCC 5', what is the sequence of nucleotides from the 5' to the 3' end in the mRNA transcript?
Chapter 17 Solutions
Inquiry In Action: Interpreting Scientific Papers
Ch. 17.1 - Prob. 1CCCh. 17.1 - What polypeptide product would you expect from a...Ch. 17.1 - Prob. 3CCCh. 17.2 - MAKE CONNECTIONS In a research artide about...Ch. 17.2 - What enables RNA polymerase to start transcribing...Ch. 17.2 - WHAT IF? Suppose X-rays caused a sequence change...Ch. 17.3 - There are about 20,000 human protein-coding genes....Ch. 17.3 - How is RNA splicing similar to how you would watch...Ch. 17.3 - Prob. 3CCCh. 17.4 - What two processes ensure that the correct amino...
Ch. 17.4 - Prob. 2CCCh. 17.4 - Prob. 3CCCh. 17.4 - WH AT IF? In eukaryotic cells, mRNAs have been...Ch. 17.5 - What happens when one nucleotide pair is lost from...Ch. 17.5 - MAKE CONNECTIONS Individuals heterozygous for the...Ch. 17.5 - WHAT IF? DRAW IT The template strand of a gene...Ch. 17 - Describe the process of gene expression, by which...Ch. 17 - What are the similarities and differences in the...Ch. 17 - What function do the 5' cap and the poly-A tail...Ch. 17 - Prob. 17.4CRCh. 17 - What will be the results of chemically modifying...Ch. 17 - In eukaryotic cells, transcription cannot begin...Ch. 17 - Which of the following is not true of a codon? (A)...Ch. 17 - The anticodon of a particular tRNA molecule is (A)...Ch. 17 - Which of the following is not true of RNA...Ch. 17 - Which component is not directly involved in...Ch. 17 - Using Figure 17.6, identify a 5' 3' sequence of...Ch. 17 - Prob. 7TYUCh. 17 - Would the coupling of the processes shown in...Ch. 17 - Prob. 9TYUCh. 17 - Prob. 10TYUCh. 17 - scientific inquiry Knowing that the genetic code...Ch. 17 - Prob. 12TYUCh. 17 - Prob. 13TYU
Additional Science Textbook Solutions
Find more solutions based on key concepts
To test your knowledge, discuss the following topics with a study partner or in writing ideally from memory. Th...
Human Anatomy
Some people compare DNA to a blueprint stored in the office of a construction company. Explain how this analogy...
Biology: Concepts and Investigations
What are the cervical and lumbar enlargements?
Principles of Anatomy and Physiology
Define histology.
Fundamentals of Anatomy & Physiology Plus Mastering A&P with eText - Access Card Package (10th Edition) (New A&P Titles by Ric Martini and Judi Nath)
The pedigrees indicated here were obtained with three unrelated families whose members express the same disease...
Genetics: From Genes to Genomes
6. How can you use the features found in each chapter?
Human Anatomy & Physiology
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Given the template DNA sequence: 3’ - TAC - CAG - GTT - ACC - ATC - 5’ A.) What will be the mRNA requence corresponding to the template DNA sequence? B.) What is the amino acid sequence in letter A? ( e.g. Arg, Phe, etc.) C.) If the coding sequence of the dsDNA will "serve" as the template for transcription, what is the corresponding mRNA sequence? D.) With the mRNA transcript in letter C, what will be the amino acid sequence? ( e.g. Arg, Phe, etc.)arrow_forwardConsider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-Tyrarrow_forwardThe following sequence is a double stranded DNA. 5'ATTTGACAATGCGTTAGGCATGACTATGTATAATGCATGCCACATACT... 3' 3'TAAACTGTTACGCAATCCGTACTGATACATATTACGTACGGTGTATGA…5' -35 -10 +1 Where does RNA polymerase initially binds?arrow_forward
- Which of the molecules of RNA is the most likely to fold into a specific structure as a result of intramolecular (within itself) base-pairing? Explain. 5′-CCCUAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUAGGG-3′ 5′-UGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG-3′ 5′-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3′ 5′-GGAAAAGGAGAUGGGCAAGGGGAAAAGGAGAUGGGCAAGG-3′arrow_forwardThe template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ Following translation process, what is the amino acid sequence that will be coded for? (show your answer using THREE-letter amino acid code starting from N-terminus to C-terminus)arrow_forwardThe template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ Following translation process, what is the amino acid sequence that will be coded for? (show your answer using ONE-letter amino acid code starting from N-terminus to C-terminus)arrow_forward
- Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA: polypeptide chain:arrow_forward-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTTarrow_forwardGiven the following stretch of mRNA, what would be the sequence of the corresponding non-template DNA? 5' - UUG-CAA-UCG-CAG-UGC-CGC-AUA-GAU - 3' Group of answer choices 3' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 5' 5' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 3' 5' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 3' 3' - AAC-GUU-AGC-GUC-ACG-GCG-UAU-CUA - 5' 3' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 5'arrow_forward
- Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.arrow_forwardRefer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?arrow_forwardTo create a DNA:RNA hybrid from a short stretch of DNA with the sequence 5'-GGCTAAGTATGCCTAGTAGC-3', design the corresponding RNA sequence. Indicate the sequence in a 5' to 3' manner. What type of helix (A, B or Z) will this double-stranded nucleic acid form?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY