EBK BIOLOGY
11th Edition
ISBN: 8220102797352
Author: Raven
Publisher: YUZU
expand_more
expand_more
format_list_bulleted
Question
Chapter 18, Problem 7U
Summary Introduction
Introduction:
The term proteome is coined by Marc Wilkins in 1994. This term is applied to many different types of systems in biology such as cellular proteome, complete proteome and so on. In eukaryotes, proteome can be greater than genome.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What is the genetic code?
a. The relationship between a three-base codon sequence and an amino acid or the end of translation
b. The entire base sequence of an mRNA molecule
c. The entire sequence from the promoter to the terminator of a gene
d. The binding of tRNA to mRNA
There may be multiple answers to each question.
How is translation different in prokaryotes and eukaryotes?
a. In prokaryotes, because they do not have a nucleus, the translation of mRNA occurs while it is being transcribed b. In prokaryotes, pre-mRNA translation before transcription occurs within the cell
c.In prokaryotes, reverse trancriptase simultaneously translates and transcribes mRNAd.In prokaryotes, functional mRNA allows for translation to be skipped, and proteins are made during transcription
Chapter 18 Solutions
EBK BIOLOGY
Ch. 18 - A genetic map provides a. the sequence of the DNA...Ch. 18 - Prob. 2UCh. 18 - Approximately how many genes are there in the...Ch. 18 - An open reading frame (ORF) is distinguished by...Ch. 18 - What is a BLAST search? a. A mechanism for...Ch. 18 - Prob. 6UCh. 18 - Prob. 7UCh. 18 - Prob. 8UCh. 18 - Prob. 1ACh. 18 - Prob. 2A
Knowledge Booster
Similar questions
- The CFTR membrane protein has an alpha helix that spans the membrane. The amino acid sequence of the central portion of this alpha helix, which is embedded within the membrane, is which one of the sequences below? Sequences are provided in the single letter code. a. VVVEVVVVEVVEEEVE b. VVVLVVVVLVVLLLVL c. VVVLVVVVREERRRER d. EEEREEEEREERRRERarrow_forwardWhat is the correct tRNA anti-codon sequence for the AUG mRNA sequences? a. UGA b. UAC c. CAU d. AUGarrow_forwardWhich sequences are spliced out of the mRNA strand before leaving the nucleus? In other words, which sequences are not part of the code for the amino acids? a. exons b. intronsarrow_forward
- Refer to the figure to answer these questions:a. Add labels for mRNA (including the 5′ and 3′ ends) and tRNA. Inaddition, draw in the RNA polymerase enzyme and the ribosomes,including arrows indicating the direction of movement for each.b. What are the next three amino acids to be added to polypeptide b?c. Fill in the nucleotides in the mRNA complementary to thetemplate DNA strand.d. What is the sequence of the DNA complementary to the templatestrand (as much as can be determined from the figure)?e. Does this figure show the entire polypeptide that this geneencodes? How can you tell?f. What might happen to polypeptide b after its release from theribosome?g. Does this figure depict a prokaryotic or a eukaryotic cell? How canyou tell?arrow_forwardWhat strategy does a genetically encoded calcium indicator look like to allow fluorescence imaging of only one cell type in an acute slice of the brain? A.The use of fluorescent protein expression inhibitors in other cells B.The injection of a recombinant virus causing the death of other cells C.The use of a promoter specific to these cells D.Activation of membrane receptors specific to these cellsarrow_forwardGiven: 3' TAC CAG TTA AGC CTC GGT ATC CAG GAT ACG 5' What would be the first 10 bases at the 5' end of the complementary strand? A. 5' TCG CGTATC C 3' C. 5' GGC TTA ACT G 3' E. none of the choices B. 5' ATG GTC AATT 3' D. 5' CGT ATC CTG G 3' WRITE THE CAPITAL LETTER OF YOUR ANSWER.arrow_forward
- What are the three phases of creating pre-mRNA? a. Initiation, Elongation and Termination b. Replication, Translation and Transliteration c. Initiation, Procession and Graduation d.arrow_forwardUse the pre-mRNA sequence shown below to answer the following questions. MRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3' a. Underline the 5' and 3' splice sites, then write the sequence of the spliced mRNA in the space provided. b. Predict what would happen if the G in the 5' splice site were mutated to a C. c. We learned in this topic that the 5' cap in an mRNA plays a role in translation initiation. What do you think is one plausible mechanism by which a 5' cap can enhance initiation ? How can you experimentally demonstrate that a 5' cap is important for this process ?arrow_forwardA promoter is ______. a. a specific sequence of DNA nucleotides b. a specific sequence of RNA nucleotides c. a protein that binds to DNA d. an enzyme that synthesizes RNAarrow_forward
- what is the first event to take place in translation in eukaryotic cell? a. An clongation of the polypeptide chain by the addition of amino acids b. Binding of the larger ribosomal subunits to the smaller ribosomal subunits c. Base pairing of activated methionine-tRNA to AUG of messenger RNA d. The small subunits of ribosome recognizing and attaching to 5' cap of mRNAarrow_forwardWhich mode of information transfer in the Centra Dogma does not occur in the real world (which is not physiological)? a. RNA to DNA b. DNA to protein c. RNA to Protein d. DNA to RNAarrow_forwardWhat is a signal peptide? A. A sequence of amino acids in endomembrane system proteins that directs them to the endoplasmic reticulum B. The sequence of amino acids in every protein that determines its location in the cell C. A protein that directs other proteins where to go in the cell D. A sequence of amino acids that gets added to proteins that are free-floating in the cytoplasmarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College