BIOLOGY
12th Edition
ISBN: 9781260169614
Author: Raven
Publisher: RENT MCG
expand_more
expand_more
format_list_bulleted
Question
Chapter 18, Problem 7U
Summary Introduction
Introduction:
The term proteome is coined by Marc Wilkins in 1994. This term is applied to many different types of systems in biology such as cellular proteome, complete proteome and so on. In eukaryotes, proteome can be greater than genome.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What is the role of Proteinase K in DNA isolation?
A. Inhibit enzymes
B Catalyze breakdown of nuclei acids
C Degrade proteins
D Remove disultide bongs in proteins
How could learning about genetic engineering help scientists to mass produce proteins and other substances that can be used for treatment of diseases in large quantities?
What is the advantage of studying the mRNA present in a cell rather than the DNA?
A. The mRNA is more chemically stable at room temperature.
B. The mRNA identifies which genes are expressed.
C. The mRNA identifies inheritance patterns.
D. The mRNA is better able to undergo PCR.
Chapter 18 Solutions
BIOLOGY
Ch. 18.1 - Prob. 1LOCh. 18.1 - Describe the pros and cons of restriction mapping,...Ch. 18.1 - Prob. 3LOCh. 18.2 - Discriminate between dideoxy terminator sequencing...Ch. 18.2 - Prob. 2LOCh. 18.3 - Describe the findings of the Human Genome Project.Ch. 18.3 - Prob. 2LOCh. 18.3 - Prob. 3LOCh. 18.4 - Prob. 1LOCh. 18.4 - Prob. 2LO
Ch. 18.4 - Prob. 3LOCh. 18.5 - Prob. 1LOCh. 18.5 - Prob. 2LOCh. 18.5 - Prob. 3LOCh. 18.6 - Prob. 1LOCh. 18 - Prob. 1DACh. 18 - If the human genome contains approximately 3...Ch. 18 - Prob. 1IQCh. 18 - Prob. 2IQCh. 18 - Prob. 3IQCh. 18 - Prob. 4IQCh. 18 - Prob. 5IQCh. 18 - Prob. 6IQCh. 18 - A genetic map provides a. the sequence of the DNA...Ch. 18 - Prob. 2UCh. 18 - Approximately how many genes are there in the...Ch. 18 - An open reading frame (ORF) is distinguished by...Ch. 18 - What is a BLAST search? a. A mechanism for...Ch. 18 - Prob. 6UCh. 18 - Prob. 7UCh. 18 - Prob. 8UCh. 18 - Prob. 1ACh. 18 - Prob. 2ACh. 18 - Prob. 3ACh. 18 - Prob. 4ACh. 18 - What information can be obtained from a DNA...Ch. 18 - Prob. 6ACh. 18 - Prob. 7ACh. 18 - You are in the early stages of a genome-sequencing...Ch. 18 - Genomic research can be used to determine if an...
Knowledge Booster
Similar questions
- A promoter is ______. a. a specific sequence of DNA nucleotides b. a specific sequence of RNA nucleotides c. a protein that binds to DNA d. an enzyme that synthesizes RNAarrow_forwardOther than obvious changes in protein-encoding Neanderthal genes, changes in what type of non-coding DNA sequences would affect cell function? A) Alu family of repeated sequences B) Short tandem repeats (STRs) C) Protein factors that regulate gene expression D) Short interspersed nuclear elements (SINEs)arrow_forwardGive typing answer with explanation and conclusion What the examples of the application of molecular cloning techniques in biotechnological projects?arrow_forward
- Which technique allows a researcher to change a single specific nucleotide in a gene sequence in vitro? a. The CRISPR-Cas9 system b. PCR-based random mutagenesis c. PCR-based site-specific mutagenesis d. RT-PCRarrow_forwardWhy was the cold ethanol added to the soap and salt mixture? A To digest the cell walls B To dissolve the RNA C To emulsify lipids and remove large cellular debris D To precipitate the DNA E To denature the cytoplasmic proteinsarrow_forwardSearch in the human genome if there is any example of mRNA translated from two different sites ?arrow_forward
- Give typing answer with explanation and conclusion The use of which type of endonuclease is more advantageous for genetic cloning: endonucleases generating blunt ends or sticky ends?arrow_forwardWhich type of genomics studies the transcripts and proteins expressed by a genome? a. Comparative genomics b. Structural genomics c. Proteogenomics d. Functional genomicsarrow_forwardInfer how COVID19 RNA might be replicated in human cells. Use the following RNA sequence (the sense strand) in your response: 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’arrow_forward
- What do genetic engineers use to create the “sticky ends” needed to splice two fragments of DNA together? a.) an amino acid sequence b.) DNA ligase c.) restriction enzymes d.) mRNAarrow_forwardWhat is a cloning vector? A. The DNA probe used to locate a particular gene in the genome. B. An agent such as plasmid, used to transfer DNA from an in vitro solution into a living cell. C. The laboratory apparatus used to clone genes. D. An enzyme that cuts DNA into restriction fragments.arrow_forwardRefer to the figure to answer these questions:a. Add labels for mRNA (including the 5′ and 3′ ends) and tRNA. Inaddition, draw in the RNA polymerase enzyme and the ribosomes,including arrows indicating the direction of movement for each.b. What are the next three amino acids to be added to polypeptide b?c. Fill in the nucleotides in the mRNA complementary to thetemplate DNA strand.d. What is the sequence of the DNA complementary to the templatestrand (as much as can be determined from the figure)?e. Does this figure show the entire polypeptide that this geneencodes? How can you tell?f. What might happen to polypeptide b after its release from theribosome?g. Does this figure depict a prokaryotic or a eukaryotic cell? How canyou tell?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College