Campbell Biology in Focus (2nd Edition)
2nd Edition
ISBN: 9780321962751
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 18.5, Problem 2CC
Summary Introduction
To explain:
How multiple exons might have arisen in the ancestral EGF and fibronectin genes, with reference to the data provided in the “Figure 18.14”.
Introduction:
The part of the gene that encodes for RNA is known as exon. During RNA splicing the non-coding part introns are removed and the exons are covalently bond to generate mature mRNA (messenger RNA). Just as the genome is the entire set of gene, exome is the entire set of exons.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Explain why genes A2 and B2 in Figure 20.9 are orthologs and not paralogs.
What are the functions of transcriptional activator proteins and repressor proteins? Explain how they work at the molecular level.
On Figure , indicate the locations of the promoters and terminators for genes a, b, and c.
Chapter 18 Solutions
Campbell Biology in Focus (2nd Edition)
Ch. 18.1 - Prob. 1CCCh. 18.2 - Prob. 1CCCh. 18.2 - Explain the advantage of the systems biology...Ch. 18.2 - Prob. 3CCCh. 18.3 - The best estimate is that the human genome...Ch. 18.3 - Prob. 2CCCh. 18.3 - Prob. 3CCCh. 18.4 - Discuss the characteristics of mammalian genomes...Ch. 18.4 - Which of the three mechanisms described in Figures...Ch. 18.4 - Prob. 3CC
Ch. 18.5 - Describe three examples of errors in cellular...Ch. 18.5 - Prob. 2CCCh. 18.5 - Prob. 3CCCh. 18.6 - Would you expect the genome of the macaque (a...Ch. 18.6 - Prob. 2CCCh. 18 - Prob. 1TYUCh. 18 - Prob. 2TYUCh. 18 - Two eukaryotic proteins have one domain in common...Ch. 18 - SCIENTIFIC INQUIRY The scientists mapping human...Ch. 18 - FOCUS ON EVOLUTION Genes important in the...Ch. 18 - FOCUS ON INFORMATION The continuity of life is...Ch. 18 - SYNTHESIZE YOUR KNOWLEDGE Insects have three...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In Figure 9-12(b), what do you think happens to thetRNA that is released from the E site?arrow_forwardIn Figure 9-12(b), what do you think happens to the tRNA that is released from the E site?arrow_forwardWhy is the ErbB family pathway an important pathway for researchers that target cancer therapy. explain in 3-5 sentences.arrow_forward
- If we were to clone this gene directly from the nuclear DNA, bacteria would not be able to express the insulin protein. Explain why this is truearrow_forwardSuppose that a 20-bp deletion occurs in the middle of exon 2 of the gene depicted in Figure 14.12a. What will be the likely effect of this deletion in the proteins produced by alternative splicing?arrow_forward. Let’s say that you have incredible skill and can isolate the white and red patches of tissue from the Drosophila eyes shown in Figure 12-24 in order to isolate mRNA from each tissue preparation. Using your knowledge of DNA techniques from Chapter 10, design an experiment that would allow you to determine whether RNA is transcribed from the white gene in the red tissue or the whitetissue or both. If you need it, you have access to radioactive white-gene DNAarrow_forward
- Explain how the presence of tryptophan favors the formation of the 3–4 stem-loop.arrow_forwardRefer to Figure 9.7, then translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5′—UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU—3′arrow_forwardFor the ovalbumin gene shown in Figure 14.3, where would the 5′ untranslated region and 3′ untranslated regions be located in the DNA and in the RNA?arrow_forward
- Refer to figure, which shows the distribution of histone H2A.Z on nucleosomes near a transcription start site. What experimental technique would have been used to generate the data for this figure? Briefly describe the operation of this technique.arrow_forwardWould a gain of function mutaion that occurs in the first exon of a gene with twelve exons more likely be missense or nonsense? Briefly explain your choice. List one disease that we studied in class that is due to a gain of function.arrow_forwardThe protein encoded by the cystic fibrosis gene is 1480amino acids long, yet the gene spans 250 kb. How is thisdifference possible?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY