(a) Alternative splicing DNA Intron 1 Intron 2 Exon 1 Exon 2 Exon 3 Transcription 3' cleavage site Pre-MRNA 5' Exon 1 ΕonΣ ΕΚΟΠΕ 3' 3' cleavage and polyadenylation 5' Exon 1 Exon 2 ΕΚΟΠΕΙΑΑΛΑA 3 Either two introns are removed to yield one MRNA... ..or two introns and exon 2 are removed to yield a different mRNA. Alternative RNA splicing MRNA 5' Exon 1 Exon 2 Exon 3 AAAAA 3' 5' Exon 1 Exon 3 AAAAA 3' Gron 2 Intron 2 Intron 1, exon 2, and intron 2 Intron 1

(a) Alternative splicing DNA Intron 1 Intron 2 Exon 1 Exon 2 Exon 3 Transcription 3' cleavage site Pre-MRNA 5' Exon 1 ΕonΣ ΕΚΟΠΕ 3' 3' cleavage and polyadenylation 5' Exon 1 Exon 2 ΕΚΟΠΕΙΑΑΛΑA 3 Either two introns are removed to yield one MRNA... ..or two introns and exon 2 are removed to yield a different mRNA. Alternative RNA splicing MRNA 5' Exon 1 Exon 2 Exon 3 AAAAA 3' 5' Exon 1 Exon 3 AAAAA 3' Gron 2 Intron 2 Intron 1, exon 2, and intron 2 Intron 1

Name: Suppose that a 20-bp deletion occurs in the middle of exon 2 of the ge
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Suppose that a 20-bp deletion occurs in the middle of exon 2 of the gene depicted in Figure 14.12a. What will be the likely effect of this deletion in the proteins produced by alternative splicing? (a) Alternative splicingDNAIntron 1Intron 2Exon 1Exo

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter16: Gene Expression

Section: Chapter Questions

Problem 17RQ: An unprocessed pre-mRNA has the following structure. Which of the following is not a possible size...

See similar textbooks

Similar questions

5’ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’ 3’TAGCGCGATCCGCGTACGATGGATCCGATAGACGGATCGATAGCTGATTAGACTAGCTCAGTC5’ Write out the pre-mRNA for this geneWrite out the mRNA for this geneHow many amino acids does this protein have? Translate the protein Label your 5’ and 3’ UTR’s
You have just gotten back the results from an RNA-seq analysis of mRNAs from liver. You had anticipatedcounting the number of reads of each mRNA to deter-mine the relative abundance of different mRNAs. But youare puzzled because many of the mRNAs have given youresults like those shown in Figure Q8–4. How is it that dif-ferent parts of an mRNA can be represented at differentlevels?
-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
The following represent deoxyribonucleotidesequences in the template strand of DNA:Sequence 1: 5'@CTTTTTTGCCAT@3'Sequence 2: 5'@ACATCAATAACT@3'Sequence 3: 5'@TACAAGGGTTCT@3'(a) For each strand, determine the mRNA sequencethat would be derived from transcription.(b) determine the amino acidsequence that is encoded by these mRNAs.(c) For Sequence 1, what is the sequence of the codingDNA strand?
Exons 1, 2 and 3 of a human gene are 156, 224 and 524 bp long respectively. The introns 1 and2 are 546 bp and 466 bp respectively.a. Draw this gene showing the promoter, exons, introns and transcription initiationsites.b. This gene is found to encode two mRNAs. One of these mRNAs is 224 bp in shorter thanthe other.i. What is the biological process giving rise to this phenomenon called?What are the sizes of the two mRNAs (in bp) produced from this gene?
Consider the following mRNA base sequence 5' CUU CAG 3 a What dipeptide is coded for this mRNA? b. What dipeptide is formed if a point mutation converts CUU to CUC? c. What dipeptide is formed it a point mutation converts CAG to AAG?
Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)
The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3' A. How many amino acids long will be the protein translated from the only reading frame available in this segment? B. If a mutation changes the third letter of the stop codon in the only reading frame available in this segment, how many amino acids long will be the protein translated?
Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?
The method of Northern blotting is used to determine the amountand size of a particular RNA transcribed in a given cell type.Alternative splicing (discussed in Chapter 14) produces mRNAsof different lengths from the same gene. The Northern blot shownhere was obtained using a DNA probe that is complementary tothe mRNA encoded by a particular gene. The mRNA in lanes 1through 4 was isolated from different cell types, and equal amountsof total cellular mRNA were added to each lane. Explain these results.
1. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.) 2. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.)
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?