BIOLOGY (LL)
5th Edition
ISBN: 9781264115495
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 19.4, Problem 1CS
Genetic Properties of Bacteria
Core Skill: Connections Look back at Figures 4.8 and 4.9. How is a nucleoid different from a nucleus found in a eukaryotic cell?
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Question -Esther is completing her PhD project in bacterial distribution in mangroves and theirbiochemical characteristics. She manages to isolate and identify around 80 differentbacterial species from the various mangrove sites. She preserves the isolates by growingthem on a tryptic soy agar supplemented with sea salt and re-streaks them every week. After8 months she notices that some of the isolates have changed their genetic sequence whencompared to the initially identified sequence. Using a diagram explain what could havehappened to the isolates when she re-streaked them repeatedly and recommend a solutionto prevent this from occurring in the future and give explanation why it is moreadvantageous.
Objective: Get a sense of how genomics, the study of the genome in its entirety,needs to think about how to go about its research.
Geonomic DNA is broken up into fragments. The 5’ and 3’ ends of each fragment(a “read”) are sequenced. The sequenced reads are assembled together intocontiguous sequences (“contigs”) based on sequence similarity.
The idea is to sequence enough random fragments so that every nucleotide in thegenome is represented on some read. The number of such fragments needed iscalled the coverage, c.
The coverage c can be calculated by the formula RL/G, where R is the number ofreads sequenced, L is the average length of a read and G is the total length of thegenome. The units of length are bases (b) or base pairs (bp).
Consider a genome whose length is 1000 bp. “Shotgun” sequencing techniquesare applied to the genome, resulting in 20 reads, with an average length of 50 bp.A very important point is that, even though 20 x 50 = 1000, there is no guaranteethat ALL…
Objective: Get a sense of how genomics, the study of the genome in its entirety,needs to think about how to go about its research.
Geonomic DNA is broken up into fragments. The 5’ and 3’ ends of each fragment(a “read”) are sequenced. The sequenced reads are assembled together intocontiguous sequences (“contigs”) based on sequence similarity.
The idea is to sequence enough random fragments so that every nucleotide in thegenome is represented on some read. The number of such fragments needed iscalled the coverage, c.
The coverage c can be calculated by the formula RL/G, where R is the number ofreads sequenced, L is the average length of a read and G is the total length of thegenome. The units of length are bases (b) or base pairs (bp).
Consider a genome whose length is 1000 bp. “Shotgun” sequencing techniquesare applied to the genome, resulting in 20 reads, with an average length of 50 bp.A very important point is that, even though 20 x 50 = 1000, there is no guaranteethat ALL…
Chapter 19 Solutions
BIOLOGY (LL)
Ch. 19.1 - Prob. 1CSCh. 19.2 - Prob. 1CSCh. 19.2 - Viral Reproductive Cycles Concept Check: From the...Ch. 19.4 - Genetic Properties of Bacteria Core Skill:...Ch. 19.4 - Prob. 1CCCh. 19.4 - Genetic Properties of Bacteria Concept Check:...Ch. 19.4 - Prob. 3CCCh. 19.5 - Prob. 1CCCh. 19.5 - Prob. 1EQCh. 19.5 - Prob. 2EQ
Ch. 19.5 - Gene Transfer Between Bacteria CoreSKILL The gene...Ch. 19.5 - Prob. 2CCCh. 19.5 - Gene Transfer Between Bacteria Core Skill:...Ch. 19.5 - Gene Transfer Between Bacteria Concept Check: Is...Ch. 19 - Prob. 1TYCh. 19 - The characteristics of viral genomes show many...Ch. 19 - During viral infection, attachment is usually...Ch. 19 - Prob. 4TYCh. 19 - Prob. 5TYCh. 19 - Prob. 6TYCh. 19 - Prob. 7TYCh. 19 - Prob. 8TYCh. 19 - Prob. 9TYCh. 19 - Prob. 10TYCh. 19 - How are viruses similar to living cells, and how...Ch. 19 - Prob. 2CQCh. 19 - Prob. 3CQCh. 19 - Prob. 1COQCh. 19 - Prob. 2COQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- VISUAL SKILLS If the DNA pol I in a given cell werenonfunctional, how would that affect the synthesis ofa leading strand? In the overview box in Figure 16.17,point out where DNA pol I would normally function onthe top leading strand.arrow_forwardINSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: The term that refers to the synthesis of DNA using the information contained in RNA is called DNA replication STAMENT 2: The number of hydrogen bonds between guanine and cytosine is 3 ANSWER: STAMENT 1: If the %A of bacteria is 30%, then the % (G+C) of the bacteria is 40% STAMENT 2: The DNA is plectonemic because one of the strand go in 5’ to 3’ direction while the other go in the 3’ to 5’ direction ANSWER: STAMENT 1: DNA replication is conservative because one of the strands in the daughter DNA comes from the parent DNA STAMENT 2: In DNA replication, the strand copied into an mRNA is called the leading strand ANSWER:arrow_forwardVISUAL SKILLS Consider the microarray in Figure 20.12.If a sample from normal tissue is labeled with a green fluorescent dye and a sample from cancerous tissue is labeledred, what color spots would represent genes you would beinterested in if you were studying cancer? Explain.arrow_forward
- What makes platinum replica EM more desirable than conventional SEM and TEM (address both, specifically) for imaging cytoskeleton?arrow_forwardExperiment: DNA Extraction from Banana The procedures are attached below. Questions: 1. What does mashing do to the fruit? And why is it needed to add detergents?2. What do you think the ethanol does? Why can’t we use room temperature ethanol?arrow_forwardProvide a brief description behind your choice? Virus-mediated transfer of cellular genetic material from one bacterial cell to another by means of virus particles is called: (A) transduction (B) transposition (C) transformation (D) transfection One strand of double-stranded DNA is mutated, changing all cytosines to uracils. After one round of replication of the mutated DNA strand, the melting temperature of the resulting DNA will: (A) be higher (B) be lower (C) remain the same (D) be double The Southern blotting technique is used for: (A) the detection of RNA fragments onmembranes by specific radioactiveantibodies (B) the detection of DNA fragments onmembranes by a radioactive DNAprobe (C) the detection of proteins on membranesusing a radioactive DNA probe (D) the detection of DNA fragments onmembranes by specific radioactiveantibodies Superoxide dismutase is an important enzyme for maintenance of red blood cells and is defective insome neurodegenerative diseases. What…arrow_forward
- Protein Synthesis and Mutation Practice • Complete the lines below by determining the mRNA transcript and amino acid sequence. • Compare the mutant DNA strands to the wild type strand. ⚫ Circle the mutation in the mutant DNA strands and describe the type of mutation (frameshift - insertion, frameshift - deletion, point - missense, point - silent, or point-nonsense). Not all of these will be used in this assignment! Wild type DNA template: 3' TACGCGTGCACGATGCAGTAGTACATC5' mRNA transcript sequence: Amino acid sequence: Mutation #1 DNA template: 3' TACGCGTGCACGATCCAGTAGTACATC5' mRNA transcript sequence: Amino acid sequence: Type of mutation: Mutation #2 DNA template: 3' TACGCGTGCTCGATGCAGTAGTACATC5' mRNA transcript sequence: Amino acid sequence: Type of mutation:arrow_forwardUsing examples, explain how biology can be studied from a microscopic approach to a global approach.arrow_forwardYes or no? Does hydrogen peroxide used for permrabilizing tissues for riboprobe entry ? Does reverse transcriptase synthesize RNA from DNA? does microarrays need to use known gene sequence?arrow_forward
- QUESTION: what difficulty will you experience if you do genetic manipulation to streptomyces spp. and how can this difficulty overcome ?? how could you modulate the gene expression for improving the productivity of an antibiotic produced by the streptomyces strain ? discuss with diagramarrow_forwardLearning Task 2: In the space below, attach three to five examples of household items/goods(wrapper or the piece of packaging) that are products of biotechnology and briefly explain how so.arrow_forward%3D 12/15 Which question MOST likely may have led to the development of recombinant DNA technology? Can human genes be integrated into bacterial DNA so Can Can DNA be cut into fragments by restriction enzymes Can human genes be introduced into the undifferentiated cells be used to and then separate into unique patterns? bacteria can copy the genes and produce their proteins? repair parts of the body? cells of people with genetic disorders using a virus? Music off Zoom In Sign out O 3:26 Lenovoarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781337392938/9781337392938_smallCoverImage.gif)
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305389892/9781305389892_smallCoverImage.gif)
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY